Incidental Mutation 'R6887:Adgrl4'
ID536985
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151542733 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 681 (I681F)
Ref Sequence ENSEMBL: ENSMUSP00000041939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046977
AA Change: I681F

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: I681F

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2474:Adgrl4 UTSW 3 151542724 missense probably benign 0.01
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
R7527:Adgrl4 UTSW 3 151439250 missense probably benign 0.08
R7597:Adgrl4 UTSW 3 151543258 missense probably damaging 1.00
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTGCATCAAACCACAAGC -3'
(R):5'- GTCACACTTCAAGGCAACAG -3'

Sequencing Primer
(F):5'- CCACAAGCCAGCTATGAGC -3'
(R):5'- GTCACACTTCAAGGCAACAGTTTTTC -3'
Posted On2018-10-18