Incidental Mutation 'R6887:Tek'
List |< first << previous [record 35 of 40] next >> last >|
ID536987
Institutional Source Beutler Lab
Gene Symbol Tek
Ensembl Gene ENSMUSG00000006386
Gene NameTEK receptor tyrosine kinase
SynonymsCd202b, Hyk, tie-2, Tie2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6887 (G1)
Quality Score211.009
Status Validated
Chromosome4
Chromosomal Location94739289-94874976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94804944 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 247 (C247S)
Ref Sequence ENSEMBL: ENSMUSP00000073595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071168
AA Change: C298S

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: C298S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 1.2e-57 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.35e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 822 1090 1.9e-138 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073939
AA Change: C247S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: C247S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 7.1e-58 PFAM
EGF_Lam 176 213 1.26e-2 SMART
EGF 216 248 2.2e1 SMART
internal_repeat_1 251 295 4.22e-7 PROSPERO
FN3 394 475 2.11e0 SMART
FN3 490 573 9.77e-5 SMART
FN3 587 669 1.18e-12 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 772 1040 1.9e-138 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102798
AA Change: C298S

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: C298S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 24 118 5e-44 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.36e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 823 1091 1.9e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Tek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Tek APN 4 94827301 missense probably benign 0.03
IGL00805:Tek APN 4 94798719 missense probably damaging 1.00
IGL00806:Tek APN 4 94798719 missense probably damaging 1.00
IGL00807:Tek APN 4 94798719 missense probably damaging 1.00
IGL00870:Tek APN 4 94873081 nonsense probably null
IGL01348:Tek APN 4 94859658 missense probably damaging 1.00
IGL01398:Tek APN 4 94849777 missense probably damaging 1.00
IGL01683:Tek APN 4 94858911 missense probably damaging 1.00
IGL01827:Tek APN 4 94739645 missense probably benign 0.24
IGL02063:Tek APN 4 94739645 missense probably benign 0.24
IGL02218:Tek APN 4 94855337 missense probably damaging 1.00
IGL02502:Tek APN 4 94853581 critical splice donor site probably null
IGL02852:Tek APN 4 94855324 missense probably damaging 1.00
IGL02995:Tek APN 4 94739640 utr 5 prime probably benign
IGL03182:Tek APN 4 94851765 missense probably damaging 1.00
IGL03247:Tek APN 4 94865443 missense possibly damaging 0.85
IGL03014:Tek UTSW 4 94827263 missense probably benign 0.05
R0022:Tek UTSW 4 94837272 missense probably damaging 0.98
R0373:Tek UTSW 4 94804341 missense probably damaging 1.00
R0479:Tek UTSW 4 94804312 missense probably benign 0.01
R1178:Tek UTSW 4 94804287 missense probably damaging 1.00
R1289:Tek UTSW 4 94804830 missense probably damaging 1.00
R1331:Tek UTSW 4 94739706 splice site probably benign
R1502:Tek UTSW 4 94781102 missense probably damaging 1.00
R1606:Tek UTSW 4 94849767 missense probably damaging 0.99
R2073:Tek UTSW 4 94827729 missense probably benign 0.01
R2075:Tek UTSW 4 94827729 missense probably benign 0.01
R2230:Tek UTSW 4 94811336 missense probably damaging 1.00
R2851:Tek UTSW 4 94820224 missense probably benign 0.30
R2852:Tek UTSW 4 94820224 missense probably benign 0.30
R3775:Tek UTSW 4 94804312 missense probably benign 0.01
R3845:Tek UTSW 4 94804872 missense probably damaging 1.00
R4114:Tek UTSW 4 94849683 missense probably damaging 0.99
R4115:Tek UTSW 4 94849683 missense probably damaging 0.99
R4273:Tek UTSW 4 94829970 missense probably damaging 1.00
R4425:Tek UTSW 4 94863667 missense probably damaging 1.00
R4488:Tek UTSW 4 94849756 missense possibly damaging 0.72
R4579:Tek UTSW 4 94863666 nonsense probably null
R4623:Tek UTSW 4 94863661 missense probably damaging 1.00
R4651:Tek UTSW 4 94780884 missense probably damaging 1.00
R4652:Tek UTSW 4 94780884 missense probably damaging 1.00
R4723:Tek UTSW 4 94799160 missense possibly damaging 0.71
R5059:Tek UTSW 4 94804314 missense probably benign 0.10
R5652:Tek UTSW 4 94855324 missense probably damaging 1.00
R5793:Tek UTSW 4 94820096 missense probably benign 0.01
R5855:Tek UTSW 4 94853553 missense probably damaging 1.00
R5912:Tek UTSW 4 94798640 missense probably damaging 1.00
R6537:Tek UTSW 4 94837324 missense probably benign 0.19
R6727:Tek UTSW 4 94853495 nonsense probably null
R6835:Tek UTSW 4 94853434 missense possibly damaging 0.94
R6883:Tek UTSW 4 94837189 missense possibly damaging 0.89
R7027:Tek UTSW 4 94865510 missense probably damaging 1.00
R7108:Tek UTSW 4 94853487 missense probably damaging 1.00
R7121:Tek UTSW 4 94811410 missense probably benign 0.19
R7220:Tek UTSW 4 94804304 missense probably damaging 1.00
R7346:Tek UTSW 4 94827296 missense probably benign
R7417:Tek UTSW 4 94811345 missense probably benign
R7465:Tek UTSW 4 94827826 critical splice donor site probably null
R7818:Tek UTSW 4 94827716 missense possibly damaging 0.67
R8098:Tek UTSW 4 94827670 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCAGCCTTTTAAGGGCGTATG -3'
(R):5'- GAAGCATCTCCTCCCAGATC -3'

Sequencing Primer
(F):5'- GGGCGTATGATTTGACTCTAAATCAG -3'
(R):5'- AGATCCGATCTCACTGTCCAATATC -3'
Posted On2018-10-18