Incidental Mutation 'R6887:Kdr'
ID536990
Institutional Source Beutler Lab
Gene Symbol Kdr
Ensembl Gene ENSMUSG00000062960
Gene Namekinase insert domain protein receptor
SynonymsFlk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location75932827-75978458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75968451 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 178 (R178S)
Ref Sequence ENSEMBL: ENSMUSP00000109144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113516]
Predicted Effect probably benign
Transcript: ENSMUST00000113516
AA Change: R178S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: R178S

DomainStartEndE-ValueType
IG 38 121 2.43e-2 SMART
IG_like 137 220 5.91e1 SMART
IG 233 327 2.64e-12 SMART
IG 339 420 1.2e-6 SMART
IG 432 546 2.14e0 SMART
IG 554 657 2.79e-2 SMART
IGc2 677 742 8.42e-20 SMART
TyrKc 832 1158 7.07e-138 SMART
low complexity region 1310 1315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Kdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Kdr APN 5 75968750 missense probably damaging 1.00
IGL01094:Kdr APN 5 75961760 missense probably benign 0.00
IGL01310:Kdr APN 5 75949601 missense probably damaging 1.00
IGL01689:Kdr APN 5 75936840 missense probably benign 0.01
IGL01986:Kdr APN 5 75952859 missense probably benign 0.18
IGL02065:Kdr APN 5 75961853 splice site probably benign
IGL02200:Kdr APN 5 75950102 splice site probably benign
IGL02272:Kdr APN 5 75961840 missense probably benign
IGL02426:Kdr APN 5 75974466 missense probably benign 0.00
IGL02483:Kdr APN 5 75936294 critical splice donor site probably null
IGL02543:Kdr APN 5 75964947 splice site probably benign
IGL02590:Kdr APN 5 75936323 missense probably benign 0.00
IGL03204:Kdr APN 5 75972382 missense possibly damaging 0.96
IGL03228:Kdr APN 5 75957048 missense probably damaging 0.97
IGL03265:Kdr APN 5 75960773 missense probably damaging 1.00
engelein UTSW 5 75952889 missense probably damaging 1.00
PIT4131001:Kdr UTSW 5 75941971 splice site probably benign
PIT4519001:Kdr UTSW 5 75936896 missense possibly damaging 0.86
R0133:Kdr UTSW 5 75951838 missense probably damaging 1.00
R0197:Kdr UTSW 5 75968422 missense possibly damaging 0.82
R0282:Kdr UTSW 5 75950100 splice site probably benign
R0309:Kdr UTSW 5 75946927 splice site probably benign
R0371:Kdr UTSW 5 75941834 missense probably benign 0.22
R0396:Kdr UTSW 5 75960728 missense possibly damaging 0.65
R0498:Kdr UTSW 5 75959138 missense probably benign 0.00
R0932:Kdr UTSW 5 75968805 missense probably benign 0.02
R1077:Kdr UTSW 5 75956231 missense probably damaging 1.00
R1183:Kdr UTSW 5 75946851 missense probably damaging 1.00
R1713:Kdr UTSW 5 75968467 missense probably benign 0.03
R1853:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R1854:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R2142:Kdr UTSW 5 75968423 missense possibly damaging 0.56
R2238:Kdr UTSW 5 75949519 missense possibly damaging 0.78
R2891:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2893:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2894:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2903:Kdr UTSW 5 75966409 missense probably damaging 1.00
R2904:Kdr UTSW 5 75966409 missense probably damaging 1.00
R3155:Kdr UTSW 5 75968405 missense probably benign 0.02
R3939:Kdr UTSW 5 75972429 nonsense probably null
R4051:Kdr UTSW 5 75968408 missense probably benign
R4151:Kdr UTSW 5 75957101 missense possibly damaging 0.94
R4433:Kdr UTSW 5 75943925 missense possibly damaging 0.61
R4687:Kdr UTSW 5 75968792 missense possibly damaging 0.81
R4691:Kdr UTSW 5 75944599 missense possibly damaging 0.79
R5185:Kdr UTSW 5 75952417 splice site probably null
R5544:Kdr UTSW 5 75960743 nonsense probably null
R6083:Kdr UTSW 5 75944366 missense probably damaging 1.00
R6477:Kdr UTSW 5 75968841 missense probably benign 0.02
R6568:Kdr UTSW 5 75961774 missense probably benign 0.01
R6647:Kdr UTSW 5 75952889 missense probably damaging 1.00
R6827:Kdr UTSW 5 75944545 missense probably damaging 1.00
R6929:Kdr UTSW 5 75978104 missense probably benign 0.16
R6993:Kdr UTSW 5 75972411 missense probably benign
R7022:Kdr UTSW 5 75972260 nonsense probably null
R7050:Kdr UTSW 5 75950120 missense probably damaging 1.00
R7099:Kdr UTSW 5 75944333 missense probably damaging 0.98
R7274:Kdr UTSW 5 75964700 missense probably benign 0.00
R7310:Kdr UTSW 5 75944325 missense probably damaging 0.99
R7565:Kdr UTSW 5 75948843 missense probably damaging 0.97
X0024:Kdr UTSW 5 75974406 missense probably damaging 1.00
Z1177:Kdr UTSW 5 75968475 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGATACTCACGTAGAAAGCTACTC -3'
(R):5'- TGGAGATGAGCTTCCCACTTTC -3'

Sequencing Primer
(F):5'- CTCACGTAGAAAGCTACTCTTTATTG -3'
(R):5'- TGAATTACAAAGCTCCCATAGGG -3'
Posted On2018-10-18