Incidental Mutation 'R6887:Lrrc61'
ID536991
Institutional Source Beutler Lab
Gene Symbol Lrrc61
Ensembl Gene ENSMUSG00000073096
Gene Nameleucine rich repeat containing 61
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48554796-48570722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 48568432 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 63 (N63T)
Ref Sequence ENSEMBL: ENSMUSP00000145141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009425] [ENSMUST00000101436] [ENSMUST00000114545] [ENSMUST00000153222] [ENSMUST00000203627] [ENSMUST00000204071] [ENSMUST00000204182] [ENSMUST00000204267] [ENSMUST00000204930]
Predicted Effect probably benign
Transcript: ENSMUST00000009425
SMART Domains Protein: ENSMUSP00000009425
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101436
AA Change: N63T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098979
Gene: ENSMUSG00000073096
AA Change: N63T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_1 54 75 1.5e-3 PFAM
Pfam:LRR_8 54 109 8.5e-9 PFAM
low complexity region 113 124 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114545
AA Change: N63T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110192
Gene: ENSMUSG00000073096
AA Change: N63T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_8 32 87 3.1e-9 PFAM
Pfam:LRR_6 52 76 1.8e-4 PFAM
Pfam:LRR_4 53 95 1.7e-12 PFAM
Pfam:LRR_1 54 74 8.6e-5 PFAM
Pfam:LRR_8 75 131 7.8e-9 PFAM
low complexity region 177 191 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153222
Predicted Effect probably damaging
Transcript: ENSMUST00000203627
AA Change: N63T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145141
Gene: ENSMUSG00000073096
AA Change: N63T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_8 30 87 1.2e-6 PFAM
Pfam:LRR_4 53 95 1.1e-6 PFAM
Pfam:LRR_1 54 75 2.1e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204071
Predicted Effect probably benign
Transcript: ENSMUST00000204182
SMART Domains Protein: ENSMUSP00000145257
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204267
SMART Domains Protein: ENSMUSP00000144793
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204930
SMART Domains Protein: ENSMUSP00000144799
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Lrrc61
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1675:Lrrc61 UTSW 6 48568774 missense possibly damaging 0.64
R1713:Lrrc61 UTSW 6 48568774 missense possibly damaging 0.64
R2352:Lrrc61 UTSW 6 48568872 missense probably benign 0.02
R5337:Lrrc61 UTSW 6 48568374 missense probably damaging 0.96
R5774:Lrrc61 UTSW 6 48568199 unclassified probably benign
R6208:Lrrc61 UTSW 6 48568905 nonsense probably null
R7835:Lrrc61 UTSW 6 48568572 missense probably benign 0.00
R7918:Lrrc61 UTSW 6 48568572 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCATGGAGCCTCCTGGAG -3'
(R):5'- AGGAAGCATTTGCACAGAGC -3'

Sequencing Primer
(F):5'- TATCATGGAGCCTCCTGGAGAGAAG -3'
(R):5'- AGCCTCAGGTGCTCCAG -3'
Posted On2018-10-18