Incidental Mutation 'R6887:Tmf1'
ID536993
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97176838 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 91 (D91E)
Ref Sequence ENSEMBL: ENSMUSP00000120093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173]
Predicted Effect probably damaging
Transcript: ENSMUST00000095664
AA Change: D91E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: D91E

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124173
AA Change: D91E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: D91E

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Meta Mutation Damage Score 0.1934 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0825:Tmf1 UTSW 6 97175995 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3953:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4398:Tmf1 UTSW 6 97178896 missense probably damaging 0.99
R4416:Tmf1 UTSW 6 97178988 missense probably damaging 1.00
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5530:Tmf1 UTSW 6 97158087 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
R7916:Tmf1 UTSW 6 97161411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACACGGAGTCTCTCACTTCAG -3'
(R):5'- GCTCCCACTTGATGACTGATG -3'

Sequencing Primer
(F):5'- AGCTGTCTCAGAAACTCTGGACTG -3'
(R):5'- CACTTCAACCTGGGGATT -3'
Posted On2018-10-18