Incidental Mutation 'R6887:Hrc'
ID536994
Institutional Source Beutler Lab
Gene Symbol Hrc
Ensembl Gene ENSMUSG00000038239
Gene Namehistidine rich calcium binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45335290-45338974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45335664 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 80 (F80L)
Ref Sequence ENSEMBL: ENSMUSP00000082459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000042194] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000210541] [ENSMUST00000211067] [ENSMUST00000211327] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably benign
Transcript: ENSMUST00000003961
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085351
AA Change: F80L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239
AA Change: F80L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210248
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect probably benign
Transcript: ENSMUST00000211067
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in impaired weight gain and weight loss around 1 year of age and increased susceptibility to induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Hrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03379:Hrc APN 7 45337255 missense probably benign 0.27
R0017:Hrc UTSW 7 45336370 missense possibly damaging 0.71
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0047:Hrc UTSW 7 45336689 missense probably benign 0.00
R0310:Hrc UTSW 7 45336497 missense probably benign
R0436:Hrc UTSW 7 45336133 missense possibly damaging 0.53
R0534:Hrc UTSW 7 45337235 unclassified probably benign
R1230:Hrc UTSW 7 45336463 missense possibly damaging 0.85
R1808:Hrc UTSW 7 45336778 missense probably damaging 0.99
R1975:Hrc UTSW 7 45336214 missense probably damaging 0.98
R1977:Hrc UTSW 7 45336214 missense probably damaging 0.98
R2258:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R2260:Hrc UTSW 7 45336681 missense possibly damaging 0.68
R3551:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R3552:Hrc UTSW 7 45336333 missense possibly damaging 0.72
R4169:Hrc UTSW 7 45336757 missense probably benign 0.00
R5085:Hrc UTSW 7 45337021 missense probably damaging 0.99
R5204:Hrc UTSW 7 45335704 missense possibly damaging 0.96
R5215:Hrc UTSW 7 45336091 missense probably damaging 0.99
R5245:Hrc UTSW 7 45335431 missense probably damaging 1.00
R5390:Hrc UTSW 7 45335485 missense probably damaging 0.96
R5432:Hrc UTSW 7 45336861 missense possibly damaging 0.72
R5756:Hrc UTSW 7 45336706 missense possibly damaging 0.85
R5761:Hrc UTSW 7 45336601 unclassified probably null
R5905:Hrc UTSW 7 45336234 missense probably damaging 0.99
R6144:Hrc UTSW 7 45336733 missense possibly damaging 0.86
R6684:Hrc UTSW 7 45336532 missense possibly damaging 0.53
R6699:Hrc UTSW 7 45335695 missense possibly damaging 0.85
R6809:Hrc UTSW 7 45336379 missense probably benign
R7178:Hrc UTSW 7 45336261 missense possibly damaging 0.53
R7208:Hrc UTSW 7 45336565 missense possibly damaging 0.53
R7258:Hrc UTSW 7 45336296 missense possibly damaging 0.70
R7310:Hrc UTSW 7 45335803 nonsense probably null
R7456:Hrc UTSW 7 45336896 missense possibly damaging 0.83
R7525:Hrc UTSW 7 45336379 missense probably benign
R7673:Hrc UTSW 7 45337234 missense probably benign 0.00
R7734:Hrc UTSW 7 45336676 missense probably benign 0.06
Z1177:Hrc UTSW 7 45336970 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCACACTTGTCTCCTTTGGG -3'
(R):5'- AGACAATGCCATCCTCATCTTCG -3'

Sequencing Primer
(F):5'- GTCTCCTTTGGGCCACAGTG -3'
(R):5'- ATCCTCATCTTCGTGGCTGTGG -3'
Posted On2018-10-18