Incidental Mutation 'R6887:Scnn1g'
ID 536996
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Name sodium channel, nonvoltage-gated 1 gamma
Synonyms ENaC gamma
MMRRC Submission 044981-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.591) question?
Stock # R6887 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121333702-121367698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121359667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 383 (S383R)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
AlphaFold Q9WU39
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: S383R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: S383R

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 78,742,231 (GRCm39) V543I probably damaging Het
Adcy5 A G 16: 35,118,960 (GRCm39) I1104V possibly damaging Het
Adgrl4 A T 3: 151,248,370 (GRCm39) I681F possibly damaging Het
Adgrv1 T A 13: 81,676,820 (GRCm39) M2004L probably benign Het
Anapc1 A G 2: 128,501,688 (GRCm39) S785P possibly damaging Het
Ap3d1 A T 10: 80,559,532 (GRCm39) I242N probably damaging Het
Arhgap5 T C 12: 52,565,927 (GRCm39) L966P probably benign Het
Atp8a1 T C 5: 67,895,794 (GRCm39) T547A probably benign Het
Cadps A G 14: 12,505,811 (GRCm38) F753S probably damaging Het
Cdc20b T C 13: 113,215,187 (GRCm39) S252P possibly damaging Het
Cep63 A G 9: 102,503,126 (GRCm39) probably benign Het
Chrna5 G T 9: 54,912,417 (GRCm39) V302L probably benign Het
Crtc2 A G 3: 90,168,378 (GRCm39) T374A probably damaging Het
Dmtf1 T G 5: 9,187,149 (GRCm39) D140A probably damaging Het
Exosc8 C T 3: 54,641,120 (GRCm39) V39M probably damaging Het
Fam135b A C 15: 71,335,164 (GRCm39) S677A probably damaging Het
Hif1an T C 19: 44,551,828 (GRCm39) Y93H probably damaging Het
Hrc T C 7: 44,985,088 (GRCm39) F80L probably benign Het
Jmjd1c A G 10: 67,025,599 (GRCm39) T139A possibly damaging Het
Kdr T G 5: 76,129,111 (GRCm39) R178S probably benign Het
Lrrc61 A C 6: 48,545,366 (GRCm39) N63T probably damaging Het
Mrc1 C T 2: 14,330,048 (GRCm39) A1219V possibly damaging Het
Neto1 T C 18: 86,516,760 (GRCm39) V359A probably benign Het
Ngly1 T C 14: 16,281,836 (GRCm38) I364T probably benign Het
Nisch C T 14: 30,907,301 (GRCm39) probably benign Het
Or2y8 C A 11: 52,036,179 (GRCm39) M59I probably benign Het
Prrc2a T C 17: 35,374,651 (GRCm39) D1333G probably damaging Het
Raly G T 2: 154,703,830 (GRCm39) V134F probably damaging Het
Rbm6 T C 9: 107,729,430 (GRCm39) Y406C probably damaging Het
Robo4 G C 9: 37,313,363 (GRCm39) E6Q possibly damaging Het
Sgtb T C 13: 104,247,659 (GRCm39) W13R probably benign Het
Slit3 T C 11: 35,435,633 (GRCm39) probably null Het
Tbc1d32 G A 10: 56,027,907 (GRCm39) Q732* probably null Het
Tek T A 4: 94,693,181 (GRCm39) C247S probably damaging Het
Tmf1 A T 6: 97,153,799 (GRCm39) D91E probably damaging Het
Usp39 A G 6: 72,310,140 (GRCm39) L326P probably damaging Het
Vmn2r7 A T 3: 64,598,248 (GRCm39) C770S probably damaging Het
Wdr31 C T 4: 62,375,802 (GRCm39) G58R probably benign Het
Zfyve26 A G 12: 79,313,223 (GRCm39) I54T probably damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121,339,660 (GRCm39) missense probably benign 0.00
IGL01824:Scnn1g APN 7 121,365,516 (GRCm39) missense probably benign 0.00
IGL02133:Scnn1g APN 7 121,342,922 (GRCm39) missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121,341,669 (GRCm39) splice site probably benign
IGL02814:Scnn1g APN 7 121,339,588 (GRCm39) missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121,345,906 (GRCm39) missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121,337,156 (GRCm39) nonsense probably null
PIT4504001:Scnn1g UTSW 7 121,341,554 (GRCm39) missense probably benign 0.30
R0230:Scnn1g UTSW 7 121,345,984 (GRCm39) splice site probably benign
R0324:Scnn1g UTSW 7 121,339,778 (GRCm39) missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121,345,802 (GRCm39) splice site probably benign
R0534:Scnn1g UTSW 7 121,366,647 (GRCm39) missense probably benign 0.00
R1747:Scnn1g UTSW 7 121,359,686 (GRCm39) missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121,337,411 (GRCm39) nonsense probably null
R2197:Scnn1g UTSW 7 121,366,519 (GRCm39) missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121,339,650 (GRCm39) missense probably benign 0.01
R4804:Scnn1g UTSW 7 121,362,303 (GRCm39) frame shift probably null
R4805:Scnn1g UTSW 7 121,345,825 (GRCm39) missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121,365,489 (GRCm39) missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121,337,438 (GRCm39) missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121,366,581 (GRCm39) missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121,337,318 (GRCm39) missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121,366,722 (GRCm39) missense probably benign 0.00
R6666:Scnn1g UTSW 7 121,366,611 (GRCm39) missense probably benign 0.00
R6735:Scnn1g UTSW 7 121,341,486 (GRCm39) missense probably benign 0.02
R6813:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R7289:Scnn1g UTSW 7 121,337,304 (GRCm39) nonsense probably null
R7488:Scnn1g UTSW 7 121,362,657 (GRCm39) missense probably benign 0.00
R7630:Scnn1g UTSW 7 121,359,704 (GRCm39) missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121,342,878 (GRCm39) missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121,342,916 (GRCm39) missense probably damaging 1.00
R9051:Scnn1g UTSW 7 121,341,566 (GRCm39) missense possibly damaging 0.86
R9312:Scnn1g UTSW 7 121,339,818 (GRCm39) missense probably benign 0.00
Z1177:Scnn1g UTSW 7 121,359,698 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTGTCTCACTGGCCATC -3'
(R):5'- GGTCTTTGGATCAACCCCAG -3'

Sequencing Primer
(F):5'- GGATTTCCCAGTGTCTACAACTG -3'
(R):5'- GGTCTTTGGATCAACCCCAGATATC -3'
Posted On 2018-10-18