Mutagenetix > Incidental Mutation

Incidental Mutation 'R6887:Robo4'

536997

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

044981-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 37402067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 6 (E6Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102895
AA Change: E6Q

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: E6Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115046
AA Change: E6Q

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: E6Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000115048
AA Change: E6Q

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: E6Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156972
AA Change: E6Q

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214185
AA Change: E6Q

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Ap3d1	A	T	10: 80,723,698	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237	A1219V	possibly damaging	Het
Neto1	T	C	18: 86,498,635	V359A	probably benign	Het
Ngly1	T	C	14: 16,281,836	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37403227	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37402635	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37405640	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37404076	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37403505	nonsense	probably null
R8547:Robo4	UTSW	9	37404378	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37408281	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37405834	missense	unknown
R8889:Robo4	UTSW	9	37403305	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37404224	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37401910	start gained	probably benign
R9375:Robo4	UTSW	9	37404862	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37406213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACAGCTGAAGTGTAGAGGTC -3'
(R):5'- AGAGATGCTCCTTTGTCCTGC -3'

Sequencing Primer
(F):5'- AGGTCAGAGAGTTTCTCACCTCTG -3'
(R):5'- GTCCTGCTGGCTTTGGATCC -3'

Posted On

2018-10-18