Incidental Mutation 'R6887:Rbm6'
List |< first << previous [record 29 of 40] next >> last >|
ID537000
Institutional Source Beutler Lab
Gene Symbol Rbm6
Ensembl Gene ENSMUSG00000032582
Gene NameRNA binding motif protein 6
Synonymsg16, NY-LU-12, Def-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107773559-107873237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107852231 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 406 (Y406C)
Ref Sequence ENSEMBL: ENSMUSP00000138400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035201] [ENSMUST00000181986] [ENSMUST00000183032] [ENSMUST00000183035] [ENSMUST00000195866] [ENSMUST00000195883]
Predicted Effect probably damaging
Transcript: ENSMUST00000035201
AA Change: Y274C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035201
Gene: ENSMUSG00000032582
AA Change: Y274C

DomainStartEndE-ValueType
internal_repeat_1 4 42 2.66e-5 PROSPERO
low complexity region 61 87 N/A INTRINSIC
internal_repeat_1 106 157 2.66e-5 PROSPERO
RRM 325 400 2.67e-2 SMART
Blast:ZnF_RBZ 406 430 2e-11 BLAST
RRM 522 601 1.32e-1 SMART
low complexity region 748 765 N/A INTRINSIC
ZnF_C2H2 818 843 4.34e0 SMART
low complexity region 864 876 N/A INTRINSIC
G_patch 912 958 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181986
Predicted Effect probably damaging
Transcript: ENSMUST00000183032
AA Change: Y406C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138400
Gene: ENSMUSG00000032582
AA Change: Y406C

DomainStartEndE-ValueType
internal_repeat_1 43 119 2.42e-5 PROSPERO
internal_repeat_2 46 164 3.18e-5 PROSPERO
internal_repeat_1 121 189 2.42e-5 PROSPERO
low complexity region 193 219 N/A INTRINSIC
internal_repeat_2 224 319 3.18e-5 PROSPERO
RRM 457 532 2.67e-2 SMART
Blast:ZnF_RBZ 538 562 2e-9 BLAST
RRM 654 733 1.32e-1 SMART
low complexity region 880 897 N/A INTRINSIC
ZnF_C2H2 950 975 4.34e0 SMART
low complexity region 996 1008 N/A INTRINSIC
G_patch 1044 1090 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183035
Predicted Effect probably benign
Transcript: ENSMUST00000195866
Predicted Effect probably benign
Transcript: ENSMUST00000195883
SMART Domains Protein: ENSMUSP00000141953
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
Blast:ZnF_RBZ 24 48 9e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Rbm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Rbm6 APN 9 107788349 missense probably damaging 1.00
IGL01647:Rbm6 APN 9 107852882 missense probably benign 0.13
IGL01872:Rbm6 APN 9 107783715 missense probably damaging 0.99
IGL02402:Rbm6 APN 9 107852852 missense probably damaging 1.00
IGL03024:Rbm6 APN 9 107787368 missense probably damaging 0.97
IGL03025:Rbm6 APN 9 107774719 missense possibly damaging 0.76
FR4737:Rbm6 UTSW 9 107782755 frame shift probably null
PIT4402001:Rbm6 UTSW 9 107787850 missense probably damaging 1.00
R0511:Rbm6 UTSW 9 107847289 nonsense probably null
R1666:Rbm6 UTSW 9 107791856 missense probably benign 0.15
R1927:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R2173:Rbm6 UTSW 9 107852191 missense possibly damaging 0.79
R2262:Rbm6 UTSW 9 107791090 missense probably damaging 1.00
R2439:Rbm6 UTSW 9 107779597 missense probably damaging 1.00
R2566:Rbm6 UTSW 9 107791998 missense possibly damaging 0.60
R2878:Rbm6 UTSW 9 107852450 missense probably damaging 1.00
R4342:Rbm6 UTSW 9 107847247 intron probably benign
R4783:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R4785:Rbm6 UTSW 9 107787352 missense probably benign 0.06
R5205:Rbm6 UTSW 9 107788343 missense probably benign 0.08
R5253:Rbm6 UTSW 9 107852657 missense probably damaging 1.00
R5279:Rbm6 UTSW 9 107778014 missense probably benign 0.00
R5356:Rbm6 UTSW 9 107852666 missense probably damaging 1.00
R6289:Rbm6 UTSW 9 107777948 missense probably damaging 1.00
R6328:Rbm6 UTSW 9 107787259 missense probably benign 0.00
R6564:Rbm6 UTSW 9 107833498 missense probably damaging 1.00
R6978:Rbm6 UTSW 9 107852575 intron probably null
R7139:Rbm6 UTSW 9 107853211 missense probably damaging 1.00
R7240:Rbm6 UTSW 9 107852896 missense probably damaging 1.00
R7330:Rbm6 UTSW 9 107791045 missense possibly damaging 0.77
R7397:Rbm6 UTSW 9 107852519 missense probably benign
R7590:Rbm6 UTSW 9 107791750 critical splice donor site probably null
R7829:Rbm6 UTSW 9 107852706 missense probably damaging 1.00
R8301:Rbm6 UTSW 9 107852794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAATTTCCTTTTGCGTGG -3'
(R):5'- AAGACCTGCTTTTGGTGTTCAG -3'

Sequencing Primer
(F):5'- GAAGGCTTTAGTGACTAAACATCTTC -3'
(R):5'- TTCAGAAGGGAGAATTTGAGCATTC -3'
Posted On2018-10-18