Incidental Mutation 'R6887:Tbc1d32'
ID537001
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 56151811 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 732 (Q732*)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect probably null
Transcript: ENSMUST00000099739
AA Change: Q732*
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: Q732*

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTTCAACATAGTCACAAACTGGGAAG -3'
(R):5'- GCTAGGCTTAAACTCAAACCAGAAG -3'

Sequencing Primer
(F):5'- TCACAAACTGGGAAGTAGAATTTTAG -3'
(R):5'- GGTACTAATTCACTGTAAGGGTTTC -3'
Posted On2018-10-18