Mutagenetix > Incidental Mutation

Incidental Mutation 'R6887:Ap3d1'

537003

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80723698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 242 (I242N)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

AlphaFold

O54774

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: I242N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: I242N

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219356

Meta Mutation Damage Score

0.9269

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237	A1219V	possibly damaging	Het
Neto1	T	C	18: 86,498,635	V359A	probably benign	Het
Ngly1	T	C	14: 16,281,836	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
Particle	UTSW	10	80710494	splice site	probably null
vesicle	UTSW	10	80723827	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80716591	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80712118	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80709793	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80719084	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80723827	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80709821	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80709228	missense	probably benign
R9664:Ap3d1	UTSW	10	80712805	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80709775	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ACAAGGGTCGTGTCAGAATG -3'
(R):5'- CACTCTTTGCTGATGTGGACC -3'

Sequencing Primer
(F):5'- GTGTCAGAATGGCATCAATATCCCTG -3'
(R):5'- GATGTGGACCCCTCTCTTGG -3'

Posted On

2018-10-18