Incidental Mutation 'R6887:Olfr1373'
ID537004
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Nameolfactory receptor 1373
SynonymsMOR256-69_p, GA_x6K02T2QP88-3283154-3284089
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52144593-52145528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52145352 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 59 (M59I)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
Predicted Effect probably benign
Transcript: ENSMUST00000078264
AA Change: M59I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: M59I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Meta Mutation Damage Score 0.1369 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R0490:Olfr1373 UTSW 11 52144666 missense probably damaging 1.00
R1075:Olfr1373 UTSW 11 52144850 missense possibly damaging 0.94
R4050:Olfr1373 UTSW 11 52145134 missense probably damaging 1.00
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
V1662:Olfr1373 UTSW 11 52145177 missense probably damaging 1.00
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCAGCATAGCGATCTATAGCC -3'
(R):5'- AGGAAGCATTCAGTTGACTTCTG -3'

Sequencing Primer
(F):5'- CAGCATAGCGATCTATAGCCATTGTC -3'
(R):5'- GGGAAAATATGGACTATTTGAACACC -3'
Posted On2018-10-18