Incidental Mutation 'R6887:Arhgap5'
List |< first << previous [record 7 of 40] next >> last >|
ID537005
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene NameRho GTPase activating protein 5
Synonymsp190B, p190-B
MMRRC Submission
Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location52503972-52571975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52519144 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 966 (L966P)
Ref Sequence ENSEMBL: ENSMUSP00000151809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
Predicted Effect probably benign
Transcript: ENSMUST00000110725
AA Change: L966P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: L966P

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect probably benign
Transcript: ENSMUST00000219443
AA Change: L966P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52517281 missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52518742 missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52516860 missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52518240 missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52516861 missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52518353 missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52562340 missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52516965 missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52517311 missense probably damaging 0.99
Decline UTSW 12 52516582 nonsense probably null
Pass UTSW 12 52516507 missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52518882 missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52518735 nonsense probably null
R0088:Arhgap5 UTSW 12 52516548 missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52516717 missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52559960 splice site probably benign
R0356:Arhgap5 UTSW 12 52516308 missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52517065 missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52518168 missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52516507 missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52519623 missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52517144 missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52518370 missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52516848 missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52519514 missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52517376 missense probably benign
R1711:Arhgap5 UTSW 12 52519345 missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52542593 missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52518034 missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52519147 missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52519888 missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52567187 missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52517957 missense probably benign
R4703:Arhgap5 UTSW 12 52517583 missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52557492 missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52518703 missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52519209 missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52519912 missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52519779 missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52519586 missense probably benign
R5911:Arhgap5 UTSW 12 52518742 missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52517663 missense probably benign 0.11
R6988:Arhgap5 UTSW 12 52518125 missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52519639 missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52518326 missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52517376 missense probably benign
R7310:Arhgap5 UTSW 12 52542487 critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52517698 missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52516582 nonsense probably null
R7421:Arhgap5 UTSW 12 52518000 missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52516956 missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
R8079:Arhgap5 UTSW 12 52567205 missense probably benign
R8241:Arhgap5 UTSW 12 52518315 missense probably benign 0.00
X0018:Arhgap5 UTSW 12 52518397 missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52518463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGAAGGAGAACACATTGCAAC -3'
(R):5'- GAGGCACTTTATGGTTACGTTC -3'

Sequencing Primer
(F):5'- CTGAGATAACCGCTAAATTTACAGC -3'
(R):5'- CGTGACAATTTGGAGTGCTATGAAC -3'
Posted On2018-10-18