Incidental Mutation 'R6887:Sgtb'
List |< first << previous [record 32 of 40] next >> last >|
ID537008
Institutional Source Beutler Lab
Gene Symbol Sgtb
Ensembl Gene ENSMUSG00000042743
Gene Namesmall glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
SynonymsC630001O05Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_144838.1; MGI:2444615

Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location104109741-104141735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104111151 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 13 (W13R)
Ref Sequence ENSEMBL: ENSMUSP00000124895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044385] [ENSMUST00000109315] [ENSMUST00000159574] [ENSMUST00000160322] [ENSMUST00000224945]
Predicted Effect probably benign
Transcript: ENSMUST00000044385
AA Change: M21T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041307
Gene: ENSMUSG00000042743
AA Change: M21T

DomainStartEndE-ValueType
Pfam:SGTA_dimer 3 64 2.4e-19 PFAM
TPR 85 118 9.45e-6 SMART
TPR 119 152 1.01e-5 SMART
TPR 153 186 3.21e-8 SMART
Blast:STI1 213 254 5e-9 BLAST
low complexity region 266 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109315
SMART Domains Protein: ENSMUSP00000104938
Gene: ENSMUSG00000021710

DomainStartEndE-ValueType
Pfam:Peptidase_M3 251 701 1.8e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159574
AA Change: W13R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124895
Gene: ENSMUSG00000042743
AA Change: W13R

DomainStartEndE-ValueType
TPR 42 75 9.45e-6 SMART
TPR 76 109 1.01e-5 SMART
TPR 110 143 3.21e-8 SMART
Blast:STI1 170 207 5e-9 BLAST
low complexity region 223 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160322
AA Change: M21T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125569
Gene: ENSMUSG00000042743
AA Change: M21T

DomainStartEndE-ValueType
PDB:4GOF|B 5 54 4e-11 PDB
Pfam:TPR_11 83 150 5e-23 PFAM
Pfam:TPR_1 85 118 1e-8 PFAM
Pfam:TPR_2 85 118 2.1e-8 PFAM
Pfam:TPR_7 92 120 1.3e-4 PFAM
Pfam:TPR_9 93 157 2.2e-5 PFAM
Pfam:TPR_17 107 140 7.2e-8 PFAM
Pfam:TPR_1 119 152 6.5e-9 PFAM
Pfam:TPR_2 119 152 3.4e-5 PFAM
Pfam:TPR_11 131 176 2.6e-8 PFAM
Pfam:TPR_1 153 176 1.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224945
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
Allele List at MGI

All alleles(7) : Targeted(3) Gene trapped(4)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Sgtb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Sgtb APN 13 104118414 missense probably benign 0.00
IGL03225:Sgtb APN 13 104131945 missense probably damaging 1.00
P0008:Sgtb UTSW 13 104124274 missense probably damaging 1.00
R0044:Sgtb UTSW 13 104129260 missense probably benign 0.00
R1556:Sgtb UTSW 13 104139776 missense probably damaging 1.00
R2143:Sgtb UTSW 13 104124259 missense probably damaging 1.00
R6802:Sgtb UTSW 13 104132050 missense probably benign 0.04
R7086:Sgtb UTSW 13 104118416 missense possibly damaging 0.68
R8263:Sgtb UTSW 13 104132184 missense probably benign 0.00
X0014:Sgtb UTSW 13 104131968 nonsense probably null
X0014:Sgtb UTSW 13 104131969 missense probably damaging 1.00
Z1088:Sgtb UTSW 13 104131939 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCTGGACCCTTTAAAGAGAG -3'
(R):5'- AGCCGTTCTGCTGCTTAAAC -3'

Sequencing Primer
(F):5'- TTCTGGACCCTTTAAAGAGAGAAAAG -3'
(R):5'- TGTTCCCATGATGAAAAACTTCCC -3'
Posted On2018-10-18