Incidental Mutation 'R6887:Cdc20b'
ID537009
Institutional Source Beutler Lab
Gene Symbol Cdc20b
Ensembl Gene ENSMUSG00000078926
Gene Namecell division cycle 20B
SynonymsEG622422, EG238896
MMRRC Submission
Accession Numbers

Genbank: XM_138861

Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113035111-113091195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113078653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 252 (S252P)
Ref Sequence ENSEMBL: ENSMUSP00000137915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109244
AA Change: S252P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926
AA Change: S252P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000181117
AA Change: S252P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926
AA Change: S252P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000181568
AA Change: S252P

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926
AA Change: S252P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Cdc20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Cdc20b APN 13 113059785 missense possibly damaging 0.74
IGL02603:Cdc20b APN 13 113078755 missense possibly damaging 0.88
IGL02663:Cdc20b APN 13 113056131 critical splice donor site probably null
IGL03024:Cdc20b APN 13 113091042 missense possibly damaging 0.58
IGL03379:Cdc20b APN 13 113081202 missense probably damaging 1.00
H8930:Cdc20b UTSW 13 113083966 missense probably damaging 1.00
R0207:Cdc20b UTSW 13 113078612 missense probably damaging 1.00
R0347:Cdc20b UTSW 13 113059827 missense probably damaging 0.97
R0448:Cdc20b UTSW 13 113078657 missense probably damaging 1.00
R0499:Cdc20b UTSW 13 113055950 missense probably benign 0.00
R1573:Cdc20b UTSW 13 113055944 missense probably benign 0.26
R1651:Cdc20b UTSW 13 113078724 nonsense probably null
R1786:Cdc20b UTSW 13 113081134 missense probably damaging 1.00
R1929:Cdc20b UTSW 13 113071917 missense probably benign 0.07
R2118:Cdc20b UTSW 13 113078698 missense probably benign 0.30
R3436:Cdc20b UTSW 13 113078699 missense probably damaging 0.99
R3508:Cdc20b UTSW 13 113081042 missense possibly damaging 0.80
R3837:Cdc20b UTSW 13 113084008 missense probably damaging 1.00
R4050:Cdc20b UTSW 13 113064285 missense probably benign
R4521:Cdc20b UTSW 13 113081191 missense probably damaging 1.00
R4786:Cdc20b UTSW 13 113078734 missense probably damaging 1.00
R6079:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
R6610:Cdc20b UTSW 13 113064262 missense probably benign 0.02
R6814:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6872:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R7144:Cdc20b UTSW 13 113083371 missense probably benign 0.36
R7579:Cdc20b UTSW 13 113037048 intron probably null
R7770:Cdc20b UTSW 13 113078659 missense probably benign 0.01
U15987:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
X0064:Cdc20b UTSW 13 113059742 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATGATCTCATCTGGTTCAGGAC -3'
(R):5'- CATGCTGGACGTTATCTAGTGAC -3'

Sequencing Primer
(F):5'- GGTTCAGGACTTCATTTGATATCAG -3'
(R):5'- CTGGACGTTATCTAGTGACTGCAC -3'
Posted On2018-10-18