Mutagenetix > Incidental Mutations

Incidental Mutation 'R6887:Ngly1'

537011

Institutional Source

Beutler Lab

Gene Symbol

Ngly1

Ensembl Gene

ENSMUSG00000021785

Gene Name

N-glycanase 1

Synonyms

Png1, PNGase, 1110002C09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.831) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16249280-16311926 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16281836 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 364 (I364T)

Ref Sequence

ENSEMBL: ENSMUSP00000152998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000223973] [ENSMUST00000224656]

Predicted Effect

probably benign
Transcript: ENSMUST00000022310
AA Change: I364T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: I364T

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
PUG	30	91	1.83e-22	SMART
TGc	298	353	6.19e-14	SMART
Blast:PAW	376	415	2e-15	BLAST
low complexity region	416	433	N/A	INTRINSIC
Blast:PAW	434	472	3e-15	BLAST
PAW	484	576	1.05e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223973
AA Change: I238T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000224656
AA Change: I364T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Ap3d1	A	T	10: 80,723,698	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237	A1219V	possibly damaging	Het
Neto1	T	C	18: 86,498,635	V359A	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Ngly1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01807:Ngly1	APN	14	16290873	missense	probably benign	0.14
IGL02199:Ngly1	APN	14	16290844	missense	probably damaging	0.96
IGL02809:Ngly1	APN	14	16281791	missense	probably damaging	1.00
IGL02865:Ngly1	APN	14	16290939	intron	probably benign
IGL03209:Ngly1	APN	14	16281831	nonsense	probably null
IGL03290:Ngly1	APN	14	16281866	missense	probably damaging	0.98
IGL02799:Ngly1	UTSW	14	16260636	missense	probably benign
R0518:Ngly1	UTSW	14	16290774	nonsense	probably null
R0521:Ngly1	UTSW	14	16290774	nonsense	probably null
R1612:Ngly1	UTSW	14	16290867	nonsense	probably null
R1851:Ngly1	UTSW	14	16260585	missense	probably damaging	1.00
R2060:Ngly1	UTSW	14	16277877	missense	possibly damaging	0.72
R2424:Ngly1	UTSW	14	16290721	intron	probably null
R2696:Ngly1	UTSW	14	16283439	missense	possibly damaging	0.52
R3834:Ngly1	UTSW	14	16290766	intron	probably benign
R3883:Ngly1	UTSW	14	16270574	missense	probably damaging	1.00
R4700:Ngly1	UTSW	14	16281809	missense	probably benign	0.01
R5160:Ngly1	UTSW	14	16281751	missense	probably damaging	0.98
R5555:Ngly1	UTSW	14	16270508	nonsense	probably null
R5603:Ngly1	UTSW	14	16260762	missense	probably benign	0.01
R5764:Ngly1	UTSW	14	16260799	missense	probably benign
R5980:Ngly1	UTSW	14	16270509	missense	possibly damaging	0.85
R6066:Ngly1	UTSW	14	16294634	missense	probably benign	0.01
R6943:Ngly1	UTSW	14	16283467	missense	probably damaging	1.00
R7101:Ngly1	UTSW	14	16283445	missense	probably damaging	1.00
R7447:Ngly1	UTSW	14	16290844	missense	probably damaging	1.00
R7748:Ngly1	UTSW	14	16290820	missense	possibly damaging	0.62
R8123:Ngly1	UTSW	14	16260799	missense	probably benign
X0053:Ngly1	UTSW	14	16254743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCCACAAAATGTTCTTGC -3'
(R):5'- GGGACACACTGATTCCAATGAC -3'

Sequencing Primer
(F):5'- ATGTTCTTGCTAATTAACTCGGTG -3'
(R):5'- CACTGATTCCAATGACTTTATGGTG -3'

Posted On

2018-10-18