Incidental Mutation 'R6887:Ngly1'
List |< first << previous [record 24 of 40] next >> last >|
ID537011
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene NameN-glycanase 1
SynonymsPng1, PNGase, 1110002C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location16249280-16311926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16281836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 364 (I364T)
Ref Sequence ENSEMBL: ENSMUSP00000152998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000223973] [ENSMUST00000224656]
Predicted Effect probably benign
Transcript: ENSMUST00000022310
AA Change: I364T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: I364T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223973
AA Change: I238T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000224656
AA Change: I364T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16290873 missense probably benign 0.14
IGL02199:Ngly1 APN 14 16290844 missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16281791 missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16290939 intron probably benign
IGL03209:Ngly1 APN 14 16281831 nonsense probably null
IGL03290:Ngly1 APN 14 16281866 missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16260636 missense probably benign
R0518:Ngly1 UTSW 14 16290774 nonsense probably null
R0521:Ngly1 UTSW 14 16290774 nonsense probably null
R1612:Ngly1 UTSW 14 16290867 nonsense probably null
R1851:Ngly1 UTSW 14 16260585 missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16277877 missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16290721 intron probably null
R2696:Ngly1 UTSW 14 16283439 missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16290766 intron probably benign
R3883:Ngly1 UTSW 14 16270574 missense probably damaging 1.00
R4700:Ngly1 UTSW 14 16281809 missense probably benign 0.01
R5160:Ngly1 UTSW 14 16281751 missense probably damaging 0.98
R5555:Ngly1 UTSW 14 16270508 nonsense probably null
R5603:Ngly1 UTSW 14 16260762 missense probably benign 0.01
R5764:Ngly1 UTSW 14 16260799 missense probably benign
R5980:Ngly1 UTSW 14 16270509 missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16294634 missense probably benign 0.01
R6943:Ngly1 UTSW 14 16283467 missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16283445 missense probably damaging 1.00
R7447:Ngly1 UTSW 14 16290844 missense probably damaging 1.00
R7748:Ngly1 UTSW 14 16290820 missense possibly damaging 0.62
R8123:Ngly1 UTSW 14 16260799 missense probably benign
X0053:Ngly1 UTSW 14 16254743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCACAAAATGTTCTTGC -3'
(R):5'- GGGACACACTGATTCCAATGAC -3'

Sequencing Primer
(F):5'- ATGTTCTTGCTAATTAACTCGGTG -3'
(R):5'- CACTGATTCCAATGACTTTATGGTG -3'
Posted On2018-10-18