Incidental Mutation 'R6887:Nisch'
List |< first << previous [record 25 of 40] next >> last >|
ID537012
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 31185344 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000164989] [ENSMUST00000165981] [ENSMUST00000168206] [ENSMUST00000172142]
Predicted Effect unknown
Transcript: ENSMUST00000022469
AA Change: V464I
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910
AA Change: V464I

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164989
SMART Domains Protein: ENSMUSP00000126982
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_4 289 332 3.2e-8 PFAM
Pfam:LRR_1 290 311 2.9e-3 PFAM
Pfam:LRR_1 313 332 4.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165981
SMART Domains Protein: ENSMUSP00000130210
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 7.4e-2 PFAM
Pfam:LRR_6 289 309 3.8e-2 PFAM
Pfam:LRR_4 289 333 5.9e-8 PFAM
Pfam:LRR_8 289 346 6.8e-10 PFAM
Pfam:LRR_1 290 311 4.4e-3 PFAM
Pfam:LRR_8 312 369 7.3e-9 PFAM
Pfam:LRR_1 313 333 1.8e-2 PFAM
Pfam:LRR_4 329 377 2.3e-8 PFAM
Pfam:LRR_6 333 354 2e-3 PFAM
Pfam:LRR_7 334 350 1.9e-1 PFAM
Pfam:LRR_1 335 354 1.2e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000168206
AA Change: V219I
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910
AA Change: V219I

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169149
SMART Domains Protein: ENSMUSP00000131623
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Blast:PX 2 27 1e-10 BLAST
PDB:3P0C|B 2 33 7e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170253
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170436
Predicted Effect unknown
Transcript: ENSMUST00000172142
AA Change: V464I
SMART Domains Protein: ENSMUSP00000132413
Gene: ENSMUSG00000021910
AA Change: V464I

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 8.2e-2 PFAM
Pfam:LRR_6 289 309 4.2e-2 PFAM
Pfam:LRR_4 289 333 6.6e-8 PFAM
Pfam:LRR_8 289 346 7.6e-10 PFAM
Pfam:LRR_1 290 311 4.9e-3 PFAM
Pfam:LRR_8 312 369 7.7e-9 PFAM
Pfam:LRR_1 313 333 2e-2 PFAM
Pfam:LRR_4 329 377 2.7e-8 PFAM
Pfam:LRR_6 333 354 2.2e-3 PFAM
Pfam:LRR_7 334 350 2.1e-1 PFAM
Pfam:LRR_1 335 354 1.3e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 intron probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R8215:Nisch UTSW 14 31186701 missense possibly damaging 0.59
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCACTCCCAGTCTAAGGTTC -3'
(R):5'- CCAGCTCCATAGTGTCTGTACC -3'

Sequencing Primer
(F):5'- CAGTCTAAGGTTCCACAGGCAG -3'
(R):5'- GGTGTCCTTCATGTGGCCATTC -3'
Posted On2018-10-18