Mutagenetix > Incidental Mutations

Incidental Mutation 'R6887:Adcy5'

537014

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35298590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1104 (I1104V)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

AlphaFold

P84309

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114913
AA Change: I1104V

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: I1104V

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Ap3d1	A	T	10: 80,723,698	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237	A1219V	possibly damaging	Het
Neto1	T	C	18: 86,498,635	V359A	probably benign	Het
Ngly1	T	C	14: 16,281,836	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
H8786:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0927:Adcy5	UTSW	16	35156243	missense	probably benign	0.32
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1565:Adcy5	UTSW	16	35268957	missense	probably damaging	1.00
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3827:Adcy5	UTSW	16	35290097	missense	probably benign	0.03
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
R7654:Adcy5	UTSW	16	35270947	missense	probably damaging	1.00
R7718:Adcy5	UTSW	16	35280415	missense	probably benign	0.42
R7834:Adcy5	UTSW	16	35157200	missense	probably benign	0.03
R8172:Adcy5	UTSW	16	35157057	missense	probably damaging	0.96
R8772:Adcy5	UTSW	16	35299588	missense	probably damaging	1.00
R8983:Adcy5	UTSW	16	35156862	missense	possibly damaging	0.88
R9031:Adcy5	UTSW	16	35299489	missense	probably damaging	1.00
R9070:Adcy5	UTSW	16	35280400	missense	probably damaging	0.99
R9149:Adcy5	UTSW	16	35272111	missense	probably damaging	1.00
R9190:Adcy5	UTSW	16	35268994	nonsense	probably null
R9256:Adcy5	UTSW	16	35303682	missense	probably damaging	1.00
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99
Z1176:Adcy5	UTSW	16	35156321	missense	unknown
Z1176:Adcy5	UTSW	16	35290185	missense	probably benign	0.03
Z1176:Adcy5	UTSW	16	35291544	missense	not run
Z1177:Adcy5	UTSW	16	35291544	missense	not run

Predicted Primers

PCR Primer
(F):5'- AACATTCTGCCCAAGGACG -3'
(R):5'- TCATGTTCAAAGAGCAGGCAG -3'

Sequencing Primer
(F):5'- TGCCCAAGGACGTGGCTG -3'
(R):5'- CATATCAGCACGGTGACCTTAGG -3'

Posted On

2018-10-18