Mutagenetix > Incidental Mutations

Incidental Mutation 'R6887:Neto1'

537016

Institutional Source

Beutler Lab

Gene Symbol

Neto1

Ensembl Gene

ENSMUSG00000050321

Gene Name

neuropilin (NRP) and tolloid (TLL)-like 1

Synonyms

C130005O10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86394952-86501897 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86498635 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 359 (V359A)

Ref Sequence

ENSEMBL: ENSMUSP00000057340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058829]

Predicted Effect

probably benign
Transcript: ENSMUST00000058829
AA Change: V359A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: V359A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	41	155	2.06e-35	SMART
CUB	172	287	3.1e-7	SMART
LDLa	291	328	3.11e-3	SMART
transmembrane domain	341	363	N/A	INTRINSIC
low complexity region	485	497	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	G	A	7: 79,092,483	V543I	probably damaging	Het
Adcy5	A	G	16: 35,298,590	I1104V	possibly damaging	Het
Adgrl4	A	T	3: 151,542,733	I681F	possibly damaging	Het
Adgrv1	T	A	13: 81,528,701	M2004L	probably benign	Het
Anapc1	A	G	2: 128,659,768	S785P	possibly damaging	Het
Ap3d1	A	T	10: 80,723,698	I242N	probably damaging	Het
Arhgap5	T	C	12: 52,519,144	L966P	probably benign	Het
Atp8a1	T	C	5: 67,738,451	T547A	probably benign	Het
Cadps	A	G	14: 12,505,811	F753S	probably damaging	Het
Cdc20b	T	C	13: 113,078,653	S252P	possibly damaging	Het
Cep63	A	G	9: 102,625,927		probably benign	Het
Chrna5	G	T	9: 55,005,133	V302L	probably benign	Het
Crtc2	A	G	3: 90,261,071	T374A	probably damaging	Het
Dmtf1	T	G	5: 9,137,149	D140A	probably damaging	Het
Exosc8	C	T	3: 54,733,699	V39M	probably damaging	Het
Fam135b	A	C	15: 71,463,315	S677A	probably damaging	Het
Hif1an	T	C	19: 44,563,389	Y93H	probably damaging	Het
Hrc	T	C	7: 45,335,664	F80L	probably benign	Het
Jmjd1c	A	G	10: 67,189,820	T139A	possibly damaging	Het
Kdr	T	G	5: 75,968,451	R178S	probably benign	Het
Lrrc61	A	C	6: 48,568,432	N63T	probably damaging	Het
Mrc1	C	T	2: 14,325,237	A1219V	possibly damaging	Het
Ngly1	T	C	14: 16,281,836	I364T	probably benign	Het
Nisch	C	T	14: 31,185,344		probably benign	Het
Olfr1373	C	A	11: 52,145,352	M59I	probably benign	Het
Prrc2a	T	C	17: 35,155,675	D1333G	probably damaging	Het
Raly	G	T	2: 154,861,910	V134F	probably damaging	Het
Rbm6	T	C	9: 107,852,231	Y406C	probably damaging	Het
Robo4	G	C	9: 37,402,067	E6Q	possibly damaging	Het
Scnn1g	C	A	7: 121,760,444	S383R	probably benign	Het
Sgtb	T	C	13: 104,111,151	W13R	probably benign	Het
Slit3	T	C	11: 35,544,806		probably null	Het
Tbc1d32	G	A	10: 56,151,811	Q732*	probably null	Het
Tek	T	A	4: 94,804,944	C247S	probably damaging	Het
Tmf1	A	T	6: 97,176,838	D91E	probably damaging	Het
Usp39	A	G	6: 72,333,157	L326P	probably damaging	Het
Vmn2r7	A	T	3: 64,690,827	C770S	probably damaging	Het
Wdr31	C	T	4: 62,457,565	G58R	probably benign	Het
Zfyve26	A	G	12: 79,266,449	I54T	probably damaging	Het

Other mutations in Neto1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Neto1	APN	18	86498812	missense	probably damaging	0.98
IGL01505:Neto1	APN	18	86473689	missense	possibly damaging	0.82
IGL01511:Neto1	APN	18	86395908	missense	possibly damaging	0.96
IGL02704:Neto1	APN	18	86473823	missense	probably damaging	1.00
IGL03072:Neto1	APN	18	86498589	missense	probably benign	0.23
R0119:Neto1	UTSW	18	86461320	missense	probably benign	0.17
R0136:Neto1	UTSW	18	86461320	missense	probably benign	0.17
R0299:Neto1	UTSW	18	86461320	missense	probably benign	0.17
R0603:Neto1	UTSW	18	86473660	missense	possibly damaging	0.95
R0633:Neto1	UTSW	18	86404729	nonsense	probably null
R0657:Neto1	UTSW	18	86461320	missense	probably benign	0.17
R1395:Neto1	UTSW	18	86398019	splice site	probably benign
R1648:Neto1	UTSW	18	86500054	missense	probably damaging	1.00
R1852:Neto1	UTSW	18	86395884	start codon destroyed	probably null	0.53
R2249:Neto1	UTSW	18	86461274	missense	probably benign	0.02
R4418:Neto1	UTSW	18	86404856	missense	probably benign
R4476:Neto1	UTSW	18	86404673	missense	probably damaging	0.98
R4676:Neto1	UTSW	18	86398302	missense	possibly damaging	0.47
R5095:Neto1	UTSW	18	86398281	missense	probably benign
R5282:Neto1	UTSW	18	86404873	missense	probably damaging	1.00
R5337:Neto1	UTSW	18	86398309	missense	probably benign	0.00
R5400:Neto1	UTSW	18	86395908	missense	possibly damaging	0.86
R5435:Neto1	UTSW	18	86398263	missense	probably benign	0.00
R5632:Neto1	UTSW	18	86498643	missense	probably benign	0.00
R5755:Neto1	UTSW	18	86499094	missense	probably damaging	0.99
R6272:Neto1	UTSW	18	86494815	missense	probably damaging	1.00
R6486:Neto1	UTSW	18	86461246	missense	probably benign
R6505:Neto1	UTSW	18	86498574	missense	possibly damaging	0.81
R6526:Neto1	UTSW	18	86498748	missense	possibly damaging	0.47
R6582:Neto1	UTSW	18	86494860	nonsense	probably null
R7452:Neto1	UTSW	18	86498931	missense	probably benign
R7469:Neto1	UTSW	18	86498688	missense	probably benign
R7795:Neto1	UTSW	18	86461073	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGGAAAATTTTATGCTCAGCCC -3'
(R):5'- GCATTTGGAAGATGATCTCCTCAG -3'

Sequencing Primer
(F):5'- ATGCTCAGCCCATTTTGCTTTAAAG -3'
(R):5'- TGGAAGATGATCTCCTCAGTTTATG -3'

Posted On

2018-10-18