Incidental Mutation 'R6887:Hif1an'
List |< first << previous [record 17 of 40] next >> last >|
ID537017
Institutional Source Beutler Lab
Gene Symbol Hif1an
Ensembl Gene ENSMUSG00000036450
Gene Namehypoxia-inducible factor 1, alpha subunit inhibitor
SynonymsA830014H24Rik, 2310046M24Rik, FIH
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44562850-44576274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44563389 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 93 (Y93H)
Ref Sequence ENSEMBL: ENSMUSP00000035326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040455]
Predicted Effect probably damaging
Transcript: ENSMUST00000040455
AA Change: Y93H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035326
Gene: ENSMUSG00000036450
AA Change: Y93H

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
JmjC 144 311 2.56e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have metabloic, behavioral and cardiopulmonary abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Jmjd1c A G 10: 67,189,820 T139A possibly damaging Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Hif1an
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Hif1an APN 19 44563390 missense probably damaging 1.00
R0442:Hif1an UTSW 19 44566012 missense probably damaging 1.00
R0681:Hif1an UTSW 19 44563323 missense probably benign 0.00
R1623:Hif1an UTSW 19 44569423 missense probably damaging 1.00
R1918:Hif1an UTSW 19 44571112 critical splice acceptor site probably null
R3778:Hif1an UTSW 19 44569408 missense probably damaging 1.00
R3779:Hif1an UTSW 19 44569408 missense probably damaging 1.00
R6755:Hif1an UTSW 19 44568452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGATTGTGGACAGAGGC -3'
(R):5'- TACTGACGGGGCAACTTACC -3'

Sequencing Primer
(F):5'- CAGGAGACACTGTTGTGAATTTGAC -3'
(R):5'- GGGGCAACTTACCGCTCTTC -3'
Posted On2018-10-18