Incidental Mutation 'R6888:Ccdc187'
ID 537020
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission 044982-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R6888 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26161659-26184569 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26179746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 238 (R238W)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: R238W

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: R238W

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: R238W
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: R238W
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 T C 11: 120,238,141 (GRCm39) Y190C probably damaging Het
Adgrv1 A G 13: 81,656,788 (GRCm39) I2902T probably damaging Het
AI429214 G A 8: 37,460,987 (GRCm39) G45D possibly damaging Het
Ambra1 A G 2: 91,599,372 (GRCm39) D164G probably damaging Het
Ap3b1 A T 13: 94,545,299 (GRCm39) Q184L probably benign Het
Arhgef17 T C 7: 100,580,027 (GRCm39) D307G possibly damaging Het
AY761185 A T 8: 21,434,571 (GRCm39) Y52* probably null Het
Bfsp1 A G 2: 143,668,639 (GRCm39) S647P probably benign Het
C130073F10Rik A G 4: 101,747,453 (GRCm39) V192A probably benign Het
Cacna1g T A 11: 94,350,033 (GRCm39) D604V probably benign Het
Ccdc170 T C 10: 4,496,854 (GRCm39) V458A possibly damaging Het
Cdh1 A G 8: 107,384,946 (GRCm39) S380G probably benign Het
Cdk5rap3 T C 11: 96,807,018 (GRCm39) H4R probably benign Het
Cftr G A 6: 18,313,729 (GRCm39) probably null Het
Cstpp1 A G 2: 91,252,239 (GRCm39) Y41H probably damaging Het
Dnajc16 A G 4: 141,504,303 (GRCm39) V219A probably benign Het
Drd3 A T 16: 43,637,502 (GRCm39) I266F probably benign Het
Dut A G 2: 125,099,044 (GRCm39) D177G probably benign Het
Esr1 A G 10: 4,807,076 (GRCm39) I331V probably benign Het
Gm11110 A G 17: 57,409,143 (GRCm39) probably benign Het
Grm7 G T 6: 111,335,314 (GRCm39) G575V possibly damaging Het
Heatr3 A G 8: 88,897,512 (GRCm39) Y531C probably damaging Het
Igfn1 A G 1: 135,910,218 (GRCm39) V122A probably benign Het
Igsf21 T C 4: 139,762,054 (GRCm39) D208G probably benign Het
Kntc1 T C 5: 123,949,373 (GRCm39) Y1915H probably damaging Het
Lamc1 A T 1: 153,138,238 (GRCm39) D205E probably damaging Het
Limch1 C T 5: 67,179,269 (GRCm39) T713I probably benign Het
Lrp1b A G 2: 41,361,138 (GRCm39) I555T probably benign Het
Lrp2 A T 2: 69,354,485 (GRCm39) F448I probably damaging Het
Marchf6 T C 15: 31,459,379 (GRCm39) K896E probably benign Het
Mroh4 T C 15: 74,485,098 (GRCm39) Y469C possibly damaging Het
Niban3 G T 8: 72,056,383 (GRCm39) R361L probably benign Het
Nos3 T C 5: 24,588,333 (GRCm39) V1060A possibly damaging Het
Nr1h4 A G 10: 89,292,404 (GRCm39) I406T probably damaging Het
Odf2l T C 3: 144,854,379 (GRCm39) probably null Het
Or2y15 A T 11: 49,351,087 (GRCm39) T194S probably damaging Het
Or5d14 A G 2: 87,880,608 (GRCm39) M120T probably damaging Het
Pals2 T G 6: 50,157,257 (GRCm39) probably null Het
Pbx2 A G 17: 34,813,081 (GRCm39) Y119C possibly damaging Het
Pdcd6ip C A 9: 113,500,905 (GRCm39) A526S probably benign Het
Prx G A 7: 27,219,059 (GRCm39) D1187N possibly damaging Het
Ptpro G A 6: 137,357,198 (GRCm39) V230I probably benign Het
Rtn3 C T 19: 7,434,614 (GRCm39) M440I probably benign Het
Sar1b T C 11: 51,679,019 (GRCm39) I96T probably damaging Het
Sds T C 5: 120,618,965 (GRCm39) probably null Het
Secisbp2 A G 13: 51,833,977 (GRCm39) T706A probably benign Het
Sorcs3 A T 19: 48,682,263 (GRCm39) M433L possibly damaging Het
Sppl2a A G 2: 126,746,912 (GRCm39) V472A probably damaging Het
Tbc1d9 A G 8: 83,998,217 (GRCm39) E1258G possibly damaging Het
Tbxas1 C A 6: 38,929,008 (GRCm39) probably benign Het
Tg T C 15: 66,568,095 (GRCm39) I1333T probably damaging Het
Tmem108 C T 9: 103,376,915 (GRCm39) G178D probably damaging Het
Tmem174 A G 13: 98,773,569 (GRCm39) L87P probably damaging Het
Tmppe T A 9: 114,233,769 (GRCm39) S23T probably damaging Het
Ttn G A 2: 76,591,447 (GRCm39) T21074I probably benign Het
Tub A G 7: 108,628,505 (GRCm39) M338V probably null Het
Vmn1r160 A T 7: 22,571,531 (GRCm39) R295* probably null Het
Vps52 T C 17: 34,182,180 (GRCm39) V518A probably benign Het
Wdr59 A G 8: 112,177,675 (GRCm39) V909A probably benign Het
Wnk1 T C 6: 119,925,742 (GRCm39) T1241A probably benign Het
Zfp882 G A 8: 72,668,130 (GRCm39) C319Y probably benign Het
Znfx1 A T 2: 166,880,860 (GRCm39) I308N possibly damaging Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26,170,960 (GRCm39) missense probably benign
IGL02989:Ccdc187 APN 2 26,166,443 (GRCm39) missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26,170,978 (GRCm39) missense probably benign
IGL03059:Ccdc187 APN 2 26,184,253 (GRCm39) missense probably null 1.00
IGL03117:Ccdc187 APN 2 26,177,980 (GRCm39) missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26,171,365 (GRCm39) missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26,184,389 (GRCm39) missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26,166,133 (GRCm39) missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26,171,087 (GRCm39) missense probably benign
R1733:Ccdc187 UTSW 2 26,183,670 (GRCm39) missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26,166,080 (GRCm39) missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26,171,029 (GRCm39) missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26,172,239 (GRCm39) intron probably benign
R4344:Ccdc187 UTSW 2 26,170,681 (GRCm39) missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26,183,451 (GRCm39) missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26,166,237 (GRCm39) missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26,183,380 (GRCm39) missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26,183,593 (GRCm39) missense probably benign
R6261:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26,179,791 (GRCm39) missense probably benign 0.02
R6958:Ccdc187 UTSW 2 26,179,731 (GRCm39) missense probably benign
R7006:Ccdc187 UTSW 2 26,171,102 (GRCm39) missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26,146,007 (GRCm39) missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26,166,186 (GRCm39) missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26,183,526 (GRCm39) missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26,170,630 (GRCm39) missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26,171,548 (GRCm39) missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26,183,814 (GRCm39) missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26,165,505 (GRCm39) missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26,170,526 (GRCm39) missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26,171,079 (GRCm39) missense probably benign
R9214:Ccdc187 UTSW 2 26,183,409 (GRCm39) missense probably benign 0.19
R9454:Ccdc187 UTSW 2 26,166,114 (GRCm39) missense possibly damaging 0.94
R9542:Ccdc187 UTSW 2 26,145,930 (GRCm39) missense possibly damaging 0.66
R9562:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9565:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9601:Ccdc187 UTSW 2 26,143,445 (GRCm39) missense possibly damaging 0.90
R9702:Ccdc187 UTSW 2 26,172,222 (GRCm39) missense unknown
R9727:Ccdc187 UTSW 2 26,171,204 (GRCm39) missense probably damaging 0.99
R9790:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
R9791:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
Z1176:Ccdc187 UTSW 2 26,171,519 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGAGACAGCCCTGCTTTAC -3'
(R):5'- CACAATGGTATGTGTTCAGATGGC -3'

Sequencing Primer
(F):5'- AGACAGCCCTGCTTTACACTCC -3'
(R):5'- CAGATGGCCTTGAGGGATG -3'
Posted On 2018-10-18