Incidental Mutation 'R6888:Bfsp1'
ID 537029
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Name beaded filament structural protein 1, in lens-CP94
Synonyms filensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock # R6888 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 143826528-143863173 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143826719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 647 (S647P)
Ref Sequence ENSEMBL: ENSMUSP00000028907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
AlphaFold A2AMT1
Predicted Effect probably benign
Transcript: ENSMUST00000028907
AA Change: S647P

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: S647P

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099296
AA Change: S653P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: S653P

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143831892 missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143827644 splice site probably benign
IGL02329:Bfsp1 APN 2 143862646 missense probably benign
IGL02354:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143826736 missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143826933 missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143827333 missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143845968 missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143827643 splice site probably null
R0657:Bfsp1 UTSW 2 143827650 splice site probably benign
R1642:Bfsp1 UTSW 2 143841763 missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143841679 missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143862678 missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143827652 splice site probably null
R3024:Bfsp1 UTSW 2 143845959 missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143831829 splice site probably benign
R4914:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143862882 missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143826971 missense probably benign
R5267:Bfsp1 UTSW 2 143827051 missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143827291 missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143827459 missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143858055 critical splice donor site probably null
R7036:Bfsp1 UTSW 2 143826923 missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143848965 missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143826875 missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143831835 critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143858117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTATTAATTACACGAGG -3'
(R):5'- AGACGTCTGGGTCCAATCAG -3'

Sequencing Primer
(F):5'- CCCTATTAATTACACGAGGGAGATG -3'
(R):5'- TCCAATCAGGGTGGACCAGTG -3'
Posted On 2018-10-18