Mutagenetix > Incidental Mutations

Incidental Mutation 'R6888:Tub'

537048

Institutional Source

Beutler Lab

Gene Symbol

Tub

Ensembl Gene

ENSMUSG00000031028

Gene Name

tubby bipartite transcription factor

Synonyms

rd5, tub

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6888 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108950338-109034460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109029298 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 338 (M338V)

Ref Sequence

ENSEMBL: ENSMUSP00000113580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474]

Predicted Effect

probably null
Transcript: ENSMUST00000033341
AA Change: M384V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: M384V

Domain	Start	End	E-Value	Type
Pfam:Tub_N	29	237	2.5e-58	PFAM
Pfam:Tub	257	499	2.4e-88	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000119474
AA Change: M338V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: M338V

Domain	Start	End	E-Value	Type
low complexity region	24	41	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	145	174	N/A	INTRINSIC
low complexity region	183	196	N/A	INTRINSIC
Pfam:Tub	211	453	2.4e-121	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	G	2: 91,421,894	Y41H	probably damaging	Het
Actg1	T	C	11: 120,347,315	Y190C	probably damaging	Het
Adgrv1	A	G	13: 81,508,669	I2902T	probably damaging	Het
AI429214	G	A	8: 36,993,833	G45D	possibly damaging	Het
Ambra1	A	G	2: 91,769,027	D164G	probably damaging	Het
Ap3b1	A	T	13: 94,408,791	Q184L	probably benign	Het
Arhgef17	T	C	7: 100,930,820	D307G	possibly damaging	Het
AY761185	A	T	8: 20,944,555	Y52*	probably null	Het
Bfsp1	A	G	2: 143,826,719	S647P	probably benign	Het
C130073F10Rik	A	G	4: 101,890,256	V192A	probably benign	Het
Cacna1g	T	A	11: 94,459,207	D604V	probably benign	Het
Ccdc170	T	C	10: 4,546,854	V458A	possibly damaging	Het
Ccdc187	G	A	2: 26,289,734	R238W	probably damaging	Het
Cdh1	A	G	8: 106,658,314	S380G	probably benign	Het
Cdk5rap3	T	C	11: 96,916,192	H4R	probably benign	Het
Cftr	G	A	6: 18,313,730		probably null	Het
Dnajc16	A	G	4: 141,776,992	V219A	probably benign	Het
Drd3	A	T	16: 43,817,139	I266F	probably benign	Het
Dut	A	G	2: 125,257,124	D177G	probably benign	Het
Esr1	A	G	10: 4,857,076	I331V	probably benign	Het
Fam129c	G	T	8: 71,603,739	R361L	probably benign	Het
Gm11110	A	G	17: 57,102,143		probably benign	Het
Grm7	G	T	6: 111,358,353	G575V	possibly damaging	Het
Heatr3	A	G	8: 88,170,884	Y531C	probably damaging	Het
Igfn1	A	G	1: 135,982,480	V122A	probably benign	Het
Igsf21	T	C	4: 140,034,743	D208G	probably benign	Het
Kntc1	T	C	5: 123,811,310	Y1915H	probably damaging	Het
Lamc1	A	T	1: 153,262,492	D205E	probably damaging	Het
Limch1	C	T	5: 67,021,926	T713I	probably benign	Het
Lrp1b	A	G	2: 41,471,126	I555T	probably benign	Het
Lrp2	A	T	2: 69,524,141	F448I	probably damaging	Het
March6	T	C	15: 31,459,233	K896E	probably benign	Het
Mpp6	T	G	6: 50,180,277		probably null	Het
Mroh4	T	C	15: 74,613,249	Y469C	possibly damaging	Het
Nos3	T	C	5: 24,383,335	V1060A	possibly damaging	Het
Nr1h4	A	G	10: 89,456,542	I406T	probably damaging	Het
Odf2l	T	C	3: 145,148,618		probably null	Het
Olfr1162	A	G	2: 88,050,264	M120T	probably damaging	Het
Olfr1387	A	T	11: 49,460,260	T194S	probably damaging	Het
Pbx2	A	G	17: 34,594,107	Y119C	possibly damaging	Het
Pdcd6ip	C	A	9: 113,671,837	A526S	probably benign	Het
Prx	G	A	7: 27,519,634	D1187N	possibly damaging	Het
Ptpro	G	A	6: 137,380,200	V230I	probably benign	Het
Rtn3	C	T	19: 7,457,249	M440I	probably benign	Het
Sar1b	T	C	11: 51,788,192	I96T	probably damaging	Het
Sds	T	C	5: 120,480,900		probably null	Het
Secisbp2	A	G	13: 51,679,941	T706A	probably benign	Het
Sorcs3	A	T	19: 48,693,824	M433L	possibly damaging	Het
Sppl2a	A	G	2: 126,904,992	V472A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,588	E1258G	possibly damaging	Het
Tbxas1	C	A	6: 38,952,074		probably benign	Het
Tg	T	C	15: 66,696,246	I1333T	probably damaging	Het
Tmem108	C	T	9: 103,499,716	G178D	probably damaging	Het
Tmem174	A	G	13: 98,637,061	L87P	probably damaging	Het
Tmppe	T	A	9: 114,404,701	S23T	probably damaging	Het
Ttn	G	A	2: 76,761,103	T21074I	probably benign	Het
Vmn1r160	A	T	7: 22,872,106	R295*	probably null	Het
Vps52	T	C	17: 33,963,206	V518A	probably benign	Het
Wdr59	A	G	8: 111,451,043	V909A	probably benign	Het
Wnk1	T	C	6: 119,948,781	T1241A	probably benign	Het
Zfp882	G	A	8: 71,914,286	C319Y	probably benign	Het
Znfx1	A	T	2: 167,038,940	I308N	possibly damaging	Het

Other mutations in Tub

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01694:Tub	APN	7	109021036	splice site	probably benign
IGL02715:Tub	APN	7	109029310	missense	probably benign
grasso	UTSW	7	109029650	missense	probably damaging	1.00
troy	UTSW	7	109020954	nonsense	probably null
R0152:Tub	UTSW	7	109020927	missense	probably damaging	1.00
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R0317:Tub	UTSW	7	109020927	missense	probably damaging	1.00
R1382:Tub	UTSW	7	109030153	missense	probably damaging	1.00
R1395:Tub	UTSW	7	109020954	nonsense	probably null
R1588:Tub	UTSW	7	109029681	missense	probably damaging	1.00
R1975:Tub	UTSW	7	109027835	missense	possibly damaging	0.74
R2047:Tub	UTSW	7	109026732	missense	probably benign	0.30
R2121:Tub	UTSW	7	109026737	missense	probably damaging	1.00
R2414:Tub	UTSW	7	109027033	missense	probably damaging	1.00
R3694:Tub	UTSW	7	109027832	missense	probably benign
R3695:Tub	UTSW	7	109027832	missense	probably benign
R4914:Tub	UTSW	7	109020954	nonsense	probably null
R5139:Tub	UTSW	7	109011102	start codon destroyed	probably null	0.53
R5347:Tub	UTSW	7	109026771	missense	possibly damaging	0.67
R5557:Tub	UTSW	7	109025718	missense	probably damaging	0.99
R6000:Tub	UTSW	7	109029650	missense	probably damaging	1.00
R6245:Tub	UTSW	7	109027058	missense	probably damaging	1.00
R7316:Tub	UTSW	7	109030171	missense	possibly damaging	0.69
R8120:Tub	UTSW	7	109025596	splice site	probably null
R8223:Tub	UTSW	7	109029326	missense	probably benign	0.33
RF005:Tub	UTSW	7	109022639	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTGTGCTAGATTTAGAGGTGAC -3'
(R):5'- TGAGCCAGACCCAAGACTTG -3'

Sequencing Primer
(F):5'- GAGGTGACTATTAGACCATCAAATG -3'
(R):5'- CTCCCAGGAATGAGGCTTCTTAG -3'

Posted On

2018-10-18