Incidental Mutation 'R6888:Heatr3'
ID537054
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88170884 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 531 (Y531C)
Ref Sequence ENSEMBL: ENSMUSP00000112812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]
Predicted Effect probably damaging
Transcript: ENSMUST00000034079
AA Change: Y648C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657
AA Change: Y648C

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121949
AA Change: Y531C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657
AA Change: Y531C

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R0763:Heatr3 UTSW 8 88158241 missense probably damaging 1.00
R1244:Heatr3 UTSW 8 88141739 missense possibly damaging 0.95
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4127:Heatr3 UTSW 8 88138311 missense probably damaging 0.99
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
R8278:Heatr3 UTSW 8 88156733 missense possibly damaging 0.50
RF025:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF040:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTCACTGACAATGGAAAAG -3'
(R):5'- TCCTCAGGAACTAGGGATAGAC -3'

Sequencing Primer
(F):5'- AAAATGGCCACATTCTCATTTTCC -3'
(R):5'- ATAGACCCAGGGCTGTTGTGC -3'
Posted On2018-10-18