Incidental Mutation 'R6888:Tmem108'
ID 537057
Institutional Source Beutler Lab
Gene Symbol Tmem108
Ensembl Gene ENSMUSG00000042757
Gene Name transmembrane protein 108
Synonyms B130017P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6888 (G1)
Quality Score 224.009
Status Not validated
Chromosome 9
Chromosomal Location 103482947-103761837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103499716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 178 (G178D)
Ref Sequence ENSEMBL: ENSMUSP00000140027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000189066] [ENSMUST00000189588]
AlphaFold Q8BHE4
Predicted Effect probably damaging
Transcript: ENSMUST00000049452
AA Change: G178D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757
AA Change: G178D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189066
AA Change: G178D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757
AA Change: G178D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189588
AA Change: G178D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757
AA Change: G178D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with drastically reduced expression exhibit decreased excitatory postsynaptic currents of dentate gyrate granule neurons, impaired sensorimotor gating, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Tmem108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Tmem108 APN 9 103484751 missense probably benign 0.04
IGL02008:Tmem108 APN 9 103489240 missense possibly damaging 0.85
IGL02318:Tmem108 APN 9 103499782 missense probably benign 0.14
R0019:Tmem108 UTSW 9 103489340 missense possibly damaging 0.93
R0092:Tmem108 UTSW 9 103489305 missense possibly damaging 0.71
R0378:Tmem108 UTSW 9 103499657 missense possibly damaging 0.71
R0781:Tmem108 UTSW 9 103484690 missense probably damaging 0.98
R1138:Tmem108 UTSW 9 103498969 missense possibly damaging 0.71
R2090:Tmem108 UTSW 9 103484777 missense possibly damaging 0.57
R2137:Tmem108 UTSW 9 103499963 missense possibly damaging 0.71
R2520:Tmem108 UTSW 9 103489282 missense possibly damaging 0.85
R4724:Tmem108 UTSW 9 103499489 missense possibly damaging 0.86
R4883:Tmem108 UTSW 9 103499077 missense possibly damaging 0.93
R5358:Tmem108 UTSW 9 103499518 missense probably damaging 0.98
R6337:Tmem108 UTSW 9 103499761 missense possibly damaging 0.95
R7223:Tmem108 UTSW 9 103499534 missense not run
R8014:Tmem108 UTSW 9 103499407 missense probably benign 0.04
R8139:Tmem108 UTSW 9 103499885 missense probably benign 0.02
R8355:Tmem108 UTSW 9 103499870 missense possibly damaging 0.86
R8455:Tmem108 UTSW 9 103499870 missense possibly damaging 0.86
R8937:Tmem108 UTSW 9 103484782 missense probably benign 0.15
R8940:Tmem108 UTSW 9 103499957 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTGTGTCGAAGAGAAGTAGCCC -3'
(R):5'- ACGTCTACAGTGATGGGGAC -3'

Sequencing Primer
(F):5'- AGAAGTAGCCCCCGAGTG -3'
(R):5'- GCATCCCGAAAGTCCTCTG -3'
Posted On 2018-10-18