Incidental Mutation 'R6888:Esr1'
ID537061
Institutional Source Beutler Lab
Gene Symbol Esr1
Ensembl Gene ENSMUSG00000019768
Gene Nameestrogen receptor 1 (alpha)
SynonymsERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location4611593-5005614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4857076 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 331 (I331V)
Ref Sequence ENSEMBL: ENSMUSP00000101213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105588] [ENSMUST00000105589] [ENSMUST00000105590]
Predicted Effect probably benign
Transcript: ENSMUST00000067086
AA Change: I331V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768
AA Change: I331V

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105588
AA Change: I331V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101213
Gene: ENSMUSG00000019768
AA Change: I331V

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 1.7e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 493 4.19e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105589
AA Change: I331V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768
AA Change: I331V

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 2.3e-64 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105590
AA Change: I331V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768
AA Change: I331V

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Esr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Esr1 APN 10 4997890 missense probably benign 0.00
IGL01886:Esr1 APN 10 4856861 missense probably damaging 0.98
IGL02174:Esr1 APN 10 4998003 missense probably damaging 1.00
IGL02625:Esr1 APN 10 5001346 missense probably benign 0.00
IGL02938:Esr1 APN 10 4783872 missense probably damaging 1.00
IGL03232:Esr1 APN 10 4969270 missense probably damaging 1.00
cybernetic UTSW 10 4783874 missense probably damaging 1.00
terminatrix UTSW 10 4746760 missense probably damaging 1.00
R0280:Esr1 UTSW 10 4856951 missense probably benign 0.05
R0280:Esr1 UTSW 10 4939289 missense probably damaging 0.99
R0479:Esr1 UTSW 10 4997911 missense probably damaging 1.00
R0943:Esr1 UTSW 10 4746781 missense probably damaging 1.00
R1437:Esr1 UTSW 10 4712571 small deletion probably benign
R1581:Esr1 UTSW 10 4997905 missense probably damaging 1.00
R1644:Esr1 UTSW 10 5001380 missense probably benign 0.00
R1647:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1648:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1791:Esr1 UTSW 10 4783913 missense probably damaging 1.00
R1955:Esr1 UTSW 10 4857125 missense probably damaging 1.00
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R4323:Esr1 UTSW 10 5001307 missense possibly damaging 0.48
R4727:Esr1 UTSW 10 5001418 missense probably benign 0.00
R5009:Esr1 UTSW 10 4712394 missense probably damaging 1.00
R5578:Esr1 UTSW 10 4969164 missense probably damaging 1.00
R5610:Esr1 UTSW 10 5001221 missense probably damaging 1.00
R5836:Esr1 UTSW 10 4712817 missense probably benign 0.02
R5938:Esr1 UTSW 10 4966245 intron probably benign
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6173:Esr1 UTSW 10 4746760 missense probably damaging 1.00
R6575:Esr1 UTSW 10 4966301 intron probably benign
R7271:Esr1 UTSW 10 4783874 missense probably damaging 1.00
R7310:Esr1 UTSW 10 4939259 missense probably damaging 1.00
R7552:Esr1 UTSW 10 4856903 missense probably damaging 1.00
R8218:Esr1 UTSW 10 4746808 critical splice donor site probably null
R8553:Esr1 UTSW 10 4997847 missense probably damaging 1.00
R8801:Esr1 UTSW 10 4966270 missense unknown
R8904:Esr1 UTSW 10 4746654 missense possibly damaging 0.95
R8924:Esr1 UTSW 10 4857176 nonsense probably null
X0011:Esr1 UTSW 10 4712571 small deletion probably benign
X0018:Esr1 UTSW 10 5001325 missense probably benign
Z1088:Esr1 UTSW 10 4712667 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCTGCATTTTCAGGCATACGG -3'
(R):5'- CAGCTGACTGTTGAAAGTTATTCAC -3'

Sequencing Primer
(F):5'- TTTTCAGGCATACGGAAAGACC -3'
(R):5'- ATGAACCAGCTCCCTATC -3'
Posted On2018-10-18