Incidental Mutation 'R6888:Secisbp2'
ID 537068
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene Name SECIS binding protein 2
Synonyms SBP2, 2210413N07Rik, 2810012K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6888 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 51651697-51684044 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51679941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 706 (T706A)
Ref Sequence ENSEMBL: ENSMUSP00000045740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117]
AlphaFold Q3U1C4
Predicted Effect probably benign
Transcript: ENSMUST00000040117
AA Change: T706A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: T706A

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1220:Secisbp2 UTSW 13 51656905 missense probably damaging 1.00
R1278:Secisbp2 UTSW 13 51654510 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5183:Secisbp2 UTSW 13 51665424 missense probably benign 0.14
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R5696:Secisbp2 UTSW 13 51679821 missense probably damaging 1.00
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
R7261:Secisbp2 UTSW 13 51682462 missense probably damaging 1.00
R7717:Secisbp2 UTSW 13 51673098 missense probably benign 0.00
R7986:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R8021:Secisbp2 UTSW 13 51665628 makesense probably null
R8496:Secisbp2 UTSW 13 51665347 missense probably damaging 1.00
R8755:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8757:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8758:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8759:Secisbp2 UTSW 13 51679833 missense possibly damaging 0.92
R8833:Secisbp2 UTSW 13 51665316 missense probably benign 0.01
R8878:Secisbp2 UTSW 13 51683368 missense probably benign 0.13
R9153:Secisbp2 UTSW 13 51679819 missense possibly damaging 0.92
R9295:Secisbp2 UTSW 13 51654447 missense probably damaging 1.00
R9528:Secisbp2 UTSW 13 51656943 missense possibly damaging 0.57
R9562:Secisbp2 UTSW 13 51683284 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAGATGCTTGTGTCACGG -3'
(R):5'- TACTACAGCTTACGGCAGGC -3'

Sequencing Primer
(F):5'- TGTCACGGGTCTGCTCAAG -3'
(R):5'- CTACCCTGTCATCAGAGGAAGAG -3'
Posted On 2018-10-18