Mutagenetix > Incidental Mutation

Incidental Mutation 'R6888:Ap3b1'

537070

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R6888 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94408791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 184 (Q184L)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably benign
Transcript: ENSMUST00000022196
AA Change: Q184L

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: Q184L

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	G	2: 91,421,894	Y41H	probably damaging	Het
Actg1	T	C	11: 120,347,315	Y190C	probably damaging	Het
Adgrv1	A	G	13: 81,508,669	I2902T	probably damaging	Het
AI429214	G	A	8: 36,993,833	G45D	possibly damaging	Het
Ambra1	A	G	2: 91,769,027	D164G	probably damaging	Het
Arhgef17	T	C	7: 100,930,820	D307G	possibly damaging	Het
AY761185	A	T	8: 20,944,555	Y52*	probably null	Het
Bfsp1	A	G	2: 143,826,719	S647P	probably benign	Het
C130073F10Rik	A	G	4: 101,890,256	V192A	probably benign	Het
Cacna1g	T	A	11: 94,459,207	D604V	probably benign	Het
Ccdc170	T	C	10: 4,546,854	V458A	possibly damaging	Het
Ccdc187	G	A	2: 26,289,734	R238W	probably damaging	Het
Cdh1	A	G	8: 106,658,314	S380G	probably benign	Het
Cdk5rap3	T	C	11: 96,916,192	H4R	probably benign	Het
Cftr	G	A	6: 18,313,730		probably null	Het
Dnajc16	A	G	4: 141,776,992	V219A	probably benign	Het
Drd3	A	T	16: 43,817,139	I266F	probably benign	Het
Dut	A	G	2: 125,257,124	D177G	probably benign	Het
Esr1	A	G	10: 4,857,076	I331V	probably benign	Het
Fam129c	G	T	8: 71,603,739	R361L	probably benign	Het
Gm11110	A	G	17: 57,102,143		probably benign	Het
Grm7	G	T	6: 111,358,353	G575V	possibly damaging	Het
Heatr3	A	G	8: 88,170,884	Y531C	probably damaging	Het
Igfn1	A	G	1: 135,982,480	V122A	probably benign	Het
Igsf21	T	C	4: 140,034,743	D208G	probably benign	Het
Kntc1	T	C	5: 123,811,310	Y1915H	probably damaging	Het
Lamc1	A	T	1: 153,262,492	D205E	probably damaging	Het
Limch1	C	T	5: 67,021,926	T713I	probably benign	Het
Lrp1b	A	G	2: 41,471,126	I555T	probably benign	Het
Lrp2	A	T	2: 69,524,141	F448I	probably damaging	Het
March6	T	C	15: 31,459,233	K896E	probably benign	Het
Mpp6	T	G	6: 50,180,277		probably null	Het
Mroh4	T	C	15: 74,613,249	Y469C	possibly damaging	Het
Nos3	T	C	5: 24,383,335	V1060A	possibly damaging	Het
Nr1h4	A	G	10: 89,456,542	I406T	probably damaging	Het
Odf2l	T	C	3: 145,148,618		probably null	Het
Olfr1162	A	G	2: 88,050,264	M120T	probably damaging	Het
Olfr1387	A	T	11: 49,460,260	T194S	probably damaging	Het
Pbx2	A	G	17: 34,594,107	Y119C	possibly damaging	Het
Pdcd6ip	C	A	9: 113,671,837	A526S	probably benign	Het
Prx	G	A	7: 27,519,634	D1187N	possibly damaging	Het
Ptpro	G	A	6: 137,380,200	V230I	probably benign	Het
Rtn3	C	T	19: 7,457,249	M440I	probably benign	Het
Sar1b	T	C	11: 51,788,192	I96T	probably damaging	Het
Sds	T	C	5: 120,480,900		probably null	Het
Secisbp2	A	G	13: 51,679,941	T706A	probably benign	Het
Sorcs3	A	T	19: 48,693,824	M433L	possibly damaging	Het
Sppl2a	A	G	2: 126,904,992	V472A	probably damaging	Het
Tbc1d9	A	G	8: 83,271,588	E1258G	possibly damaging	Het
Tbxas1	C	A	6: 38,952,074		probably benign	Het
Tg	T	C	15: 66,696,246	I1333T	probably damaging	Het
Tmem108	C	T	9: 103,499,716	G178D	probably damaging	Het
Tmem174	A	G	13: 98,637,061	L87P	probably damaging	Het
Tmppe	T	A	9: 114,404,701	S23T	probably damaging	Het
Ttn	G	A	2: 76,761,103	T21074I	probably benign	Het
Tub	A	G	7: 109,029,298	M338V	probably null	Het
Vmn1r160	A	T	7: 22,872,106	R295*	probably null	Het
Vps52	T	C	17: 33,963,206	V518A	probably benign	Het
Wdr59	A	G	8: 111,451,043	V909A	probably benign	Het
Wnk1	T	C	6: 119,948,781	T1241A	probably benign	Het
Zfp882	G	A	8: 71,914,286	C319Y	probably benign	Het
Znfx1	A	T	2: 167,038,940	I308N	possibly damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTGCTTTCATCTAGTCCTTAAC -3'
(R):5'- GACATGAGCTTCACTAATAATTACACC -3'

Sequencing Primer
(F):5'- AACGTTCTCTGGCTGGC -3'
(R):5'- CATTGAAAGTCAGCGCTC -3'

Posted On

2018-10-18