Mutagenetix > Incidental Mutation

Incidental Mutation 'R6889:Ubr3'

537084

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

044983-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6889 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69944300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 488 (D488V)

Ref Sequence

ENSEMBL: ENSMUSP00000107870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

AlphaFold

Q5U430

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055758
AA Change: D489V

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: D489V

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112251
AA Change: D488V

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: D488V

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,943,053	D103E	probably benign	Het
Abcc3	A	T	11: 94,375,555	S70T	possibly damaging	Het
Atp6v0a1	A	G	11: 101,029,183	Y214C	possibly damaging	Het
Azi2	A	G	9: 118,049,895		probably null	Het
BC067074	C	A	13: 113,318,378	S319R	probably damaging	Het
Cacnb2	T	A	2: 14,986,015	V636E	possibly damaging	Het
Cd8a	A	C	6: 71,374,562	T169P	probably damaging	Het
Cfap44	G	A	16: 44,404,132	V68I	probably benign	Het
Eea1	G	T	10: 96,037,478	C1134F	probably benign	Het
Ehmt2	T	G	17: 34,912,772	F1192V	probably damaging	Het
Emc1	T	C	4: 139,365,350	F531L	probably damaging	Het
Eme1	G	A	11: 94,650,477	T173I	probably benign	Het
Gli2	A	T	1: 118,844,416	C520S	probably damaging	Het
Gm43302	T	C	5: 105,280,138	K186E	probably benign	Het
Gpr108	A	T	17: 57,236,990	N405K	probably damaging	Het
Hmgcl	C	A	4: 135,955,642	T135N	probably benign	Het
Hydin	G	A	8: 110,532,856	D2487N	possibly damaging	Het
Igfl3	G	T	7: 18,179,800	R25L	probably benign	Het
Igsf10	A	C	3: 59,331,933	S276A	probably benign	Het
Kctd1	A	G	18: 14,973,988	S211P	probably damaging	Het
Kctd7	A	T	5: 130,152,501	Q255L	probably benign	Het
Lrig1	A	G	6: 94,625,063	Y270H	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	G	16: 49,153,111	N1248S	possibly damaging	Het
Nod1	A	G	6: 54,944,109	F408S	probably benign	Het
Nrp1	T	C	8: 128,493,057	F652S	probably damaging	Het
Olfr1338	G	A	4: 118,754,307	T79I	probably damaging	Het
Olfr487	A	T	7: 108,211,918	F204I	probably benign	Het
Olfr574	A	T	7: 102,948,768	H91L	possibly damaging	Het
Olfr821	T	C	10: 130,034,532	M302T	probably benign	Het
Opa1	G	T	16: 29,620,868	R792L	probably benign	Het
Pcdha6	G	T	18: 36,968,343	L196F	probably damaging	Het
Pdia2	A	T	17: 26,196,970	Y347*	probably null	Het
Pdpr	G	T	8: 111,124,613		probably null	Het
Pigt	T	A	2: 164,507,331	L518Q	probably damaging	Het
Ppfibp2	A	C	7: 107,737,981	D591A	possibly damaging	Het
Prrg2	G	A	7: 45,059,989	T97M	possibly damaging	Het
Qars	A	G	9: 108,513,183	T428A	probably damaging	Het
Rai1	T	C	11: 60,185,715	F202L	probably damaging	Het
Rars	A	T	11: 35,808,486	M660K	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a6	A	C	11: 109,455,040	F382V	probably damaging	Het
Slc30a7	T	C	3: 115,954,153	T330A	probably damaging	Het
Smc1b	A	T	15: 85,067,759	L1157Q	probably damaging	Het
Snx4	G	T	16: 33,251,470	A4S	possibly damaging	Het
Sv2b	A	C	7: 75,125,767		probably null	Het
Syt9	A	T	7: 107,425,286	I129L	probably damaging	Het
Ttbk2	T	C	2: 120,773,353	E198G	probably damaging	Het
Ush2a	T	A	1: 188,797,871	C3286S	probably damaging	Het
Vill	A	G	9: 119,065,882	D56G	possibly damaging	Het
Vmn1r41	A	T	6: 89,747,370	I298F	probably damaging	Het
Vmn2r2	A	T	3: 64,117,267	V631D	probably damaging	Het
Vmn2r32	A	G	7: 7,472,574	S437P	possibly damaging	Het
Vmn2r53	A	G	7: 12,601,142	V197A	probably benign	Het
Wasf1	A	T	10: 40,920,369	I32F	probably damaging	Het
Wasf2	G	T	4: 133,194,730	A387S	unknown	Het
Wdr92	G	A	11: 17,222,309	V133M	probably damaging	Het
Zbtb14	G	A	17: 69,387,679	C124Y	probably damaging	Het
Zfp462	G	T	4: 55,007,671	A37S	probably damaging	Het
Zfp532	A	G	18: 65,686,990	E882G	possibly damaging	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R7991:Ubr3	UTSW	2	69952856	missense	probably damaging	1.00
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
R8675:Ubr3	UTSW	2	70020521	missense	probably damaging	1.00
R8834:Ubr3	UTSW	2	70003441	missense	probably benign
R8975:Ubr3	UTSW	2	69922307	missense	probably damaging	1.00
R9060:Ubr3	UTSW	2	70009145	nonsense	probably null
R9153:Ubr3	UTSW	2	69965478	missense
R9234:Ubr3	UTSW	2	69897646	missense	probably benign
R9293:Ubr3	UTSW	2	69897425	missense	probably benign	0.02
R9312:Ubr3	UTSW	2	69954333	missense	probably damaging	1.00
R9710:Ubr3	UTSW	2	69897613	missense	possibly damaging	0.94
R9762:Ubr3	UTSW	2	70009153	missense	probably benign	0.00
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTCCTCTAGTTTAAGAATGAAG -3'
(R):5'- TTGATTCAAAGGATGAGACACCTG -3'

Sequencing Primer
(F):5'- GAGTTTGATCTAGCATCTGAACAG -3'
(R):5'- AGGATGAGACACCTGATTTATAACC -3'

Posted On

2018-10-18