Incidental Mutation 'R6889:Ubr3'
ID537084
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69944300 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 488 (D488V)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055758
AA Change: D489V

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: D489V

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112251
AA Change: D488V

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: D488V

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 intron probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTCCTCTAGTTTAAGAATGAAG -3'
(R):5'- TTGATTCAAAGGATGAGACACCTG -3'

Sequencing Primer
(F):5'- GAGTTTGATCTAGCATCTGAACAG -3'
(R):5'- AGGATGAGACACCTGATTTATAACC -3'
Posted On2018-10-18