Incidental Mutation 'R6889:Pigt'
ID537086
Institutional Source Beutler Lab
Gene Symbol Pigt
Ensembl Gene ENSMUSG00000017721
Gene Namephosphatidylinositol glycan anchor biosynthesis, class T
Synonyms2510012P17Rik, 4930534E15Rik, NDAP, Ndap7, CGI-06
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164497520-164508301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164507331 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 518 (L518Q)
Ref Sequence ENSEMBL: ENSMUSP00000099390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103101] [ENSMUST00000117066]
Predicted Effect probably damaging
Transcript: ENSMUST00000103101
AA Change: L518Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099390
Gene: ENSMUSG00000017721
AA Change: L518Q

DomainStartEndE-ValueType
Pfam:Gpi16 22 576 4.9e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117066
SMART Domains Protein: ENSMUSP00000112577
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 11 419 4.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152522
SMART Domains Protein: ENSMUSP00000115362
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 21 134 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null mutation do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Pigt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03076:Pigt APN 2 164497665 missense probably damaging 1.00
BB003:Pigt UTSW 2 164499669 frame shift probably null
R1548:Pigt UTSW 2 164501519 missense probably benign 0.37
R1551:Pigt UTSW 2 164507403 missense probably damaging 0.99
R1605:Pigt UTSW 2 164507499 missense probably damaging 1.00
R3712:Pigt UTSW 2 164501645 missense probably benign 0.00
R3848:Pigt UTSW 2 164498580 critical splice donor site probably benign
R4672:Pigt UTSW 2 164497578 unclassified probably benign
R4719:Pigt UTSW 2 164501624 missense probably damaging 0.98
R5481:Pigt UTSW 2 164506422 missense probably damaging 1.00
R5567:Pigt UTSW 2 164501562 nonsense probably null
R5570:Pigt UTSW 2 164501562 nonsense probably null
R5998:Pigt UTSW 2 164507454 missense possibly damaging 0.82
R6112:Pigt UTSW 2 164506445 nonsense probably null
R6816:Pigt UTSW 2 164501132 missense probably damaging 1.00
R7019:Pigt UTSW 2 164499669 frame shift probably null
R7037:Pigt UTSW 2 164499669 frame shift probably null
R7197:Pigt UTSW 2 164502516 missense probably damaging 1.00
R7288:Pigt UTSW 2 164499669 frame shift probably null
R7449:Pigt UTSW 2 164502499 missense probably damaging 1.00
R7822:Pigt UTSW 2 164499669 frame shift probably null
R7926:Pigt UTSW 2 164499669 frame shift probably null
R7940:Pigt UTSW 2 164499669 frame shift probably null
R8005:Pigt UTSW 2 164499669 frame shift probably null
R8019:Pigt UTSW 2 164499669 frame shift probably null
R8330:Pigt UTSW 2 164499669 frame shift probably null
R8337:Pigt UTSW 2 164499669 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCTCTGGTGAGGTGATCC -3'
(R):5'- ACGGGCTCACAGGACTAGAG -3'

Sequencing Primer
(F):5'- CTTATTGGGTGTCAGCACTAGGACC -3'
(R):5'- CTAGAGAGGGGGCACACCAC -3'
Posted On2018-10-18