Incidental Mutation 'R6889:2310002L09Rik'
ID 537091
Institutional Source Beutler Lab
Gene Symbol 2310002L09Rik
Ensembl Gene ENSMUSG00000028396
Gene Name RIKEN cDNA 2310002L09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 73939371-73950846 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73943053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 103 (D103E)
Ref Sequence ENSEMBL: ENSMUSP00000092633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030101] [ENSMUST00000095023]
AlphaFold Q9D7L5
Predicted Effect probably benign
Transcript: ENSMUST00000030101
AA Change: D103E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030101
Gene: ENSMUSG00000028396
AA Change: D103E

DomainStartEndE-ValueType
transmembrane domain 173 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095023
AA Change: D103E

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092633
Gene: ENSMUSG00000028396
AA Change: D103E

DomainStartEndE-ValueType
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in 2310002L09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:2310002L09Rik APN 4 73942719 missense possibly damaging 0.66
IGL01366:2310002L09Rik APN 4 73950700 utr 5 prime probably benign
IGL02596:2310002L09Rik APN 4 73950667 missense possibly damaging 0.94
R0841:2310002L09Rik UTSW 4 73942749 missense probably benign
R2919:2310002L09Rik UTSW 4 73950608 missense probably damaging 1.00
R6056:2310002L09Rik UTSW 4 73942878 missense probably benign 0.00
R6795:2310002L09Rik UTSW 4 73950828 start gained probably benign
R7709:2310002L09Rik UTSW 4 73942854 missense possibly damaging 0.52
R7793:2310002L09Rik UTSW 4 73942935 missense probably benign 0.05
R8517:2310002L09Rik UTSW 4 73942969 missense probably damaging 1.00
R8671:2310002L09Rik UTSW 4 73942929 missense probably damaging 1.00
R8867:2310002L09Rik UTSW 4 73942850 missense probably damaging 1.00
R8938:2310002L09Rik UTSW 4 73943187 missense probably damaging 1.00
R9618:2310002L09Rik UTSW 4 73950697 start codon destroyed probably null 0.46
Predicted Primers PCR Primer
(F):5'- AATACCTGACTCCAAAAGGAGG -3'
(R):5'- CCCCTTGTCTAAAGTGGATGC -3'

Sequencing Primer
(F):5'- TGGAGCAACGCTTGACCAG -3'
(R):5'- CTTCTGAGCACATGGTTGCAAGC -3'
Posted On 2018-10-18