Incidental Mutation 'R6889:Olfr1338'
ID537092
Institutional Source Beutler Lab
Gene Symbol Olfr1338
Ensembl Gene ENSMUSG00000095218
Gene Nameolfactory receptor 1338
SynonymsMOR259-9, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, Olfr1524-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118751975-118758737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118754307 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 79 (T79I)
Ref Sequence ENSEMBL: ENSMUSP00000149843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
Predicted Effect probably damaging
Transcript: ENSMUST00000084315
AA Change: T77I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: T77I

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214922
AA Change: T79I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216559
AA Change: T79I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Olfr1338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr1338 APN 4 118753762 missense possibly damaging 0.78
IGL02726:Olfr1338 APN 4 118753764 missense probably benign 0.00
IGL02928:Olfr1338 APN 4 118754500 missense probably damaging 1.00
IGL03102:Olfr1338 APN 4 118753934 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0299:Olfr1338 UTSW 4 118754535 start codon destroyed probably null 0.82
R0501:Olfr1338 UTSW 4 118753830 missense probably benign 0.00
R1301:Olfr1338 UTSW 4 118753619 missense probably benign
R1719:Olfr1338 UTSW 4 118753600 missense possibly damaging 0.78
R2327:Olfr1338 UTSW 4 118754134 missense probably benign 0.13
R3110:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R3112:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R4582:Olfr1338 UTSW 4 118753893 missense probably damaging 1.00
R4615:Olfr1338 UTSW 4 118754137 missense probably benign 0.34
R5640:Olfr1338 UTSW 4 118753789 missense probably benign 0.07
R6513:Olfr1338 UTSW 4 118754027 nonsense probably null
R7157:Olfr1338 UTSW 4 118754418 missense possibly damaging 0.93
R7168:Olfr1338 UTSW 4 118753851 missense probably damaging 0.98
R7378:Olfr1338 UTSW 4 118754175 missense possibly damaging 0.74
R7451:Olfr1338 UTSW 4 118753687 missense probably benign 0.03
R7770:Olfr1338 UTSW 4 118754057 missense probably benign 0.04
R7847:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACAGTATAGCGCAGTGGATAGC -3'
(R):5'- GTTTCCAAGGCAGAACCAAAG -3'

Sequencing Primer
(F):5'- GTGGATAGCAAATTGCCACATACCG -3'
(R):5'- CCAAAGTTGGGTTTCAGAGTTCATCC -3'
Posted On2018-10-18