Incidental Mutation 'R6889:Cd8a'
ID 537099
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene Name CD8 antigen, alpha chain
Synonyms Ly-35, Lyt-2, Ly-B, Ly-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71373427-71379173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 71374562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 169 (T169P)
Ref Sequence ENSEMBL: ENSMUSP00000068123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
AlphaFold P01731
PDB Structure MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION]
CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION]
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000066747
AA Change: T169P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: T169P

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172321
AA Change: T169P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: T169P

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71373707 missense probably benign 0.04
IGL02342:Cd8a APN 6 71373739 missense probably damaging 1.00
Alfalfa UTSW 6 71373728 missense probably damaging 0.99
Sprouts UTSW 6 71373929 missense probably damaging 0.97
wenzhou UTSW 6 71373872 missense probably benign 0.02
PIT4618001:Cd8a UTSW 6 71373677 missense possibly damaging 0.94
R0212:Cd8a UTSW 6 71373649 missense probably benign 0.01
R1158:Cd8a UTSW 6 71373728 missense probably damaging 0.99
R1813:Cd8a UTSW 6 71373963 missense possibly damaging 0.47
R4541:Cd8a UTSW 6 71373872 missense probably benign 0.02
R5836:Cd8a UTSW 6 71373791 missense possibly damaging 0.48
R6390:Cd8a UTSW 6 71373929 missense probably damaging 0.97
R7773:Cd8a UTSW 6 71373815 missense probably benign 0.01
Z1088:Cd8a UTSW 6 71373686 missense possibly damaging 0.85
Z1177:Cd8a UTSW 6 71374593 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTTCCTCTAGTTAAAAGCTAGGAAACG -3'
(R):5'- TCACAGGCGAAGTCCAATCC -3'

Sequencing Primer
(F):5'- AAGCTAGGAAACGGCTCCTTCTTG -3'
(R):5'- CTTCACTGACAAGATCCGAATGAATG -3'
Posted On 2018-10-18