Incidental Mutation 'R6889:Prrg2'
ID 537105
Institutional Source Beutler Lab
Gene Symbol Prrg2
Ensembl Gene ENSMUSG00000007837
Gene Name proline-rich Gla (G-carboxyglutamic acid) polypeptide 2
Synonyms 2510041M06Rik, N4WBP1, 1600014G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45053584-45062677 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45059989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 97 (T97M)
Ref Sequence ENSEMBL: ENSMUSP00000147977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003513] [ENSMUST00000007981] [ENSMUST00000107829] [ENSMUST00000209219] [ENSMUST00000209920] [ENSMUST00000210088] [ENSMUST00000210101] [ENSMUST00000210493] [ENSMUST00000210500] [ENSMUST00000210520] [ENSMUST00000210690] [ENSMUST00000211014] [ENSMUST00000211337] [ENSMUST00000211465]
AlphaFold Q8R182
Predicted Effect probably benign
Transcript: ENSMUST00000003513
SMART Domains Protein: ENSMUSP00000003513
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
Pfam:zf-NOSIP 4 78 1.2e-55 PFAM
coiled coil region 83 108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000007981
AA Change: T97M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007981
Gene: ENSMUSG00000007837
AA Change: T97M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GLA 30 97 4.2e-27 SMART
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 156 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107829
SMART Domains Protein: ENSMUSP00000103460
Gene: ENSMUSG00000003421

DomainStartEndE-ValueType
SCOP:d1rmd_2 31 79 2e-4 SMART
Blast:RING 46 226 4e-10 BLAST
Predicted Effect silent
Transcript: ENSMUST00000209219
Predicted Effect silent
Transcript: ENSMUST00000209920
Predicted Effect probably benign
Transcript: ENSMUST00000210088
Predicted Effect possibly damaging
Transcript: ENSMUST00000210101
AA Change: T97M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210493
AA Change: T72M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210500
AA Change: T88M

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210520
Predicted Effect possibly damaging
Transcript: ENSMUST00000210690
AA Change: T97M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211014
AA Change: T97M

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect silent
Transcript: ENSMUST00000211337
Predicted Effect probably benign
Transcript: ENSMUST00000211465
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass transmembrane protein containing an N-terminal gamma-carboxyglutamic acid (Gla) domain and tandem Pro/Leu-Pro-Xaa-Tyr (PY) motifs at its C-terminal end. The Gla domain is exposed on the cell surface while the PY motifs are cytoplasmic. The PY motifs of the encoded protein have been shown to interact with YAP1, a WW domain-containing protein. Therefore, it is thought that the encoded protein may be part of a signal transduction pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Prrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Prrg2 APN 7 45056742 critical splice donor site probably null
R6624:Prrg2 UTSW 7 45059986 missense probably damaging 1.00
R6785:Prrg2 UTSW 7 45060225 missense probably damaging 1.00
R7468:Prrg2 UTSW 7 45060263 missense probably benign 0.00
R9491:Prrg2 UTSW 7 45056794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGGCCATTGTGGAAAC -3'
(R):5'- TTGAGGACAACACACTGACG -3'

Sequencing Primer
(F):5'- TGGAAACAGAGGAGACACCTTGTC -3'
(R):5'- TCAGAGGACCCTGGCATC -3'
Posted On 2018-10-18