Mutagenetix > Incidental Mutations

Incidental Mutation 'R6889:Sv2b'

537106

Institutional Source

Beutler Lab

Gene Symbol

Sv2b

Ensembl Gene

ENSMUSG00000053025

Gene Name

synaptic vesicle glycoprotein 2 b

Synonyms

A830038F04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6889 (G1)

Quality Score

117.008

Status

Not validated

Chromosome

Chromosomal Location

75114894-75309262 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to C at 75125767 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]

Predicted Effect

probably null
Transcript: ENSMUST00000085164

SMART Domains

Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	93	415	3.8e-29	PFAM
Pfam:MFS_1	111	429	9.3e-25	PFAM
Pfam:MFS_1	517	681	8.2e-15	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000165175

SMART Domains

Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	89	412	1.5e-29	PFAM
Pfam:MFS_1	111	429	9.5e-25	PFAM
Pfam:Pentapeptide_4	453	528	7.9e-11	PFAM
Pfam:MFS_1	516	681	5.9e-15	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000206344

Predicted Effect

probably benign
Transcript: ENSMUST00000207001

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,943,053	D103E	probably benign	Het
Abcc3	A	T	11: 94,375,555	S70T	possibly damaging	Het
Atp6v0a1	A	G	11: 101,029,183	Y214C	possibly damaging	Het
Azi2	A	G	9: 118,049,895		probably null	Het
BC067074	C	A	13: 113,318,378	S319R	probably damaging	Het
Cacnb2	T	A	2: 14,986,015	V636E	possibly damaging	Het
Cd8a	A	C	6: 71,374,562	T169P	probably damaging	Het
Cfap44	G	A	16: 44,404,132	V68I	probably benign	Het
Eea1	G	T	10: 96,037,478	C1134F	probably benign	Het
Ehmt2	T	G	17: 34,912,772	F1192V	probably damaging	Het
Emc1	T	C	4: 139,365,350	F531L	probably damaging	Het
Eme1	G	A	11: 94,650,477	T173I	probably benign	Het
Gli2	A	T	1: 118,844,416	C520S	probably damaging	Het
Gm43302	T	C	5: 105,280,138	K186E	probably benign	Het
Gpr108	A	T	17: 57,236,990	N405K	probably damaging	Het
Hmgcl	C	A	4: 135,955,642	T135N	probably benign	Het
Hydin	G	A	8: 110,532,856	D2487N	possibly damaging	Het
Igfl3	G	T	7: 18,179,800	R25L	probably benign	Het
Igsf10	A	C	3: 59,331,933	S276A	probably benign	Het
Kctd1	A	G	18: 14,973,988	S211P	probably damaging	Het
Kctd7	A	T	5: 130,152,501	Q255L	probably benign	Het
Lrig1	A	G	6: 94,625,063	Y270H	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	G	16: 49,153,111	N1248S	possibly damaging	Het
Nod1	A	G	6: 54,944,109	F408S	probably benign	Het
Nrp1	T	C	8: 128,493,057	F652S	probably damaging	Het
Olfr1338	G	A	4: 118,754,307	T79I	probably damaging	Het
Olfr487	A	T	7: 108,211,918	F204I	probably benign	Het
Olfr574	A	T	7: 102,948,768	H91L	possibly damaging	Het
Olfr821	T	C	10: 130,034,532	M302T	probably benign	Het
Opa1	G	T	16: 29,620,868	R792L	probably benign	Het
Pcdha6	G	T	18: 36,968,343	L196F	probably damaging	Het
Pdia2	A	T	17: 26,196,970	Y347*	probably null	Het
Pdpr	G	T	8: 111,124,613		probably null	Het
Pigt	T	A	2: 164,507,331	L518Q	probably damaging	Het
Ppfibp2	A	C	7: 107,737,981	D591A	possibly damaging	Het
Prrg2	G	A	7: 45,059,989	T97M	possibly damaging	Het
Qars	A	G	9: 108,513,183	T428A	probably damaging	Het
Rai1	T	C	11: 60,185,715	F202L	probably damaging	Het
Rars	A	T	11: 35,808,486	M660K	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a6	A	C	11: 109,455,040	F382V	probably damaging	Het
Slc30a7	T	C	3: 115,954,153	T330A	probably damaging	Het
Smc1b	A	T	15: 85,067,759	L1157Q	probably damaging	Het
Snx4	G	T	16: 33,251,470	A4S	possibly damaging	Het
Syt9	A	T	7: 107,425,286	I129L	probably damaging	Het
Ttbk2	T	C	2: 120,773,353	E198G	probably damaging	Het
Ubr3	A	T	2: 69,944,300	D488V	possibly damaging	Het
Ush2a	T	A	1: 188,797,871	C3286S	probably damaging	Het
Vill	A	G	9: 119,065,882	D56G	possibly damaging	Het
Vmn1r41	A	T	6: 89,747,370	I298F	probably damaging	Het
Vmn2r2	A	T	3: 64,117,267	V631D	probably damaging	Het
Vmn2r32	A	G	7: 7,472,574	S437P	possibly damaging	Het
Vmn2r53	A	G	7: 12,601,142	V197A	probably benign	Het
Wasf1	A	T	10: 40,920,369	I32F	probably damaging	Het
Wasf2	G	T	4: 133,194,730	A387S	unknown	Het
Wdr92	G	A	11: 17,222,309	V133M	probably damaging	Het
Zbtb14	G	A	17: 69,387,679	C124Y	probably damaging	Het
Zfp462	G	T	4: 55,007,671	A37S	probably damaging	Het
Zfp532	A	G	18: 65,686,990	E882G	possibly damaging	Het

Other mutations in Sv2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01463:Sv2b	APN	7	75136455	missense	probably damaging	1.00
IGL02302:Sv2b	APN	7	75124199	missense	probably damaging	0.98
IGL02352:Sv2b	APN	7	75136449	missense	probably benign	0.01
IGL02359:Sv2b	APN	7	75136449	missense	probably benign	0.01
IGL02698:Sv2b	APN	7	75140978	critical splice donor site	probably null
IGL02713:Sv2b	APN	7	75124163	missense	possibly damaging	0.66
IGL03075:Sv2b	APN	7	75136320	missense	probably benign
IGL03392:Sv2b	APN	7	75156760	critical splice acceptor site	probably null
R0015:Sv2b	UTSW	7	75125641	missense	probably damaging	1.00
R0033:Sv2b	UTSW	7	75117741	missense	probably benign	0.00
R0033:Sv2b	UTSW	7	75117741	missense	probably benign	0.00
R0219:Sv2b	UTSW	7	75157267	critical splice donor site	probably null
R0277:Sv2b	UTSW	7	75206439	missense	possibly damaging	0.62
R0469:Sv2b	UTSW	7	75136392	missense	probably benign
R0510:Sv2b	UTSW	7	75136392	missense	probably benign
R1219:Sv2b	UTSW	7	75136412	missense	probably benign	0.01
R1307:Sv2b	UTSW	7	75206434	missense	probably damaging	1.00
R1476:Sv2b	UTSW	7	75120043	missense	possibly damaging	0.72
R1520:Sv2b	UTSW	7	75157329	missense	probably damaging	0.98
R1575:Sv2b	UTSW	7	75147677	missense	probably damaging	0.97
R1585:Sv2b	UTSW	7	75147677	missense	probably damaging	0.97
R1666:Sv2b	UTSW	7	75206341	missense	probably benign	0.01
R1712:Sv2b	UTSW	7	75149059	missense	possibly damaging	0.78
R1864:Sv2b	UTSW	7	75124080	missense	probably benign	0.17
R1993:Sv2b	UTSW	7	75206341	missense	probably benign	0.01
R2191:Sv2b	UTSW	7	75124088	missense	probably damaging	1.00
R3836:Sv2b	UTSW	7	75157428	missense	probably damaging	1.00
R4744:Sv2b	UTSW	7	75206518	missense	probably benign	0.01
R4757:Sv2b	UTSW	7	75124170	missense	probably benign	0.31
R4924:Sv2b	UTSW	7	75136421	missense	probably benign	0.20
R4990:Sv2b	UTSW	7	75117722	missense	possibly damaging	0.55
R4991:Sv2b	UTSW	7	75117722	missense	possibly damaging	0.55
R5038:Sv2b	UTSW	7	75157425	missense	probably damaging	1.00
R5726:Sv2b	UTSW	7	75124214	missense	possibly damaging	0.67
R5885:Sv2b	UTSW	7	75156753	missense	probably damaging	1.00
R6379:Sv2b	UTSW	7	75136300	missense	possibly damaging	0.73
R6410:Sv2b	UTSW	7	75140109	missense	probably benign	0.40
R6623:Sv2b	UTSW	7	75206384	missense	probably damaging	1.00
R6709:Sv2b	UTSW	7	75124139	missense	probably benign	0.40
R6873:Sv2b	UTSW	7	75206206	missense	probably damaging	1.00
R7123:Sv2b	UTSW	7	75117702	missense	possibly damaging	0.94
R7278:Sv2b	UTSW	7	75147654	missense	probably damaging	0.99
R7363:Sv2b	UTSW	7	75147654	missense	probably damaging	0.99
R7378:Sv2b	UTSW	7	75147728	critical splice acceptor site	probably null
R7426:Sv2b	UTSW	7	75124064	missense	probably damaging	1.00
R7452:Sv2b	UTSW	7	75147713	missense	probably damaging	1.00
R7504:Sv2b	UTSW	7	75136383	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TCGATTCGATGGTGCAGTTC -3'
(R):5'- CACATTTCTGTCGTGCTGATG -3'

Sequencing Primer
(F):5'- CGATGGTGCAGTTCTTGAAATAC -3'
(R):5'- CGTGCTGATGGGAAGGTCC -3'

Posted On

2018-10-18