Incidental Mutation 'R6889:Olfr574'
ID 537108
Institutional Source Beutler Lab
Gene Symbol Olfr574
Ensembl Gene ENSMUSG00000045824
Gene Name olfactory receptor 574
Synonyms GA_x6K02T2PBJ9-5659738-5660748, MOR14-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102948467-102949507 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102948768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 91 (H91L)
Ref Sequence ENSEMBL: ENSMUSP00000147694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052997] [ENSMUST00000211329] [ENSMUST00000213477] [ENSMUST00000216420]
AlphaFold F8VQ18
Predicted Effect possibly damaging
Transcript: ENSMUST00000052997
AA Change: H101L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095815
Gene: ENSMUSG00000045824
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7tm_4 44 323 3.8e-96 PFAM
Pfam:7TM_GPCR_Srsx 48 195 1.2e-8 PFAM
Pfam:7tm_1 54 305 2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211329
AA Change: H91L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213477
Predicted Effect probably benign
Transcript: ENSMUST00000216420
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Olfr574
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Olfr574 APN 7 102948839 missense probably damaging 1.00
IGL01732:Olfr574 APN 7 102949239 missense probably damaging 1.00
IGL02185:Olfr574 APN 7 102948514 missense probably damaging 0.96
PIT4382001:Olfr574 UTSW 7 102949449 missense probably benign
PIT4520001:Olfr574 UTSW 7 102948714 missense probably damaging 1.00
R0765:Olfr574 UTSW 7 102948732 missense probably damaging 1.00
R1616:Olfr574 UTSW 7 102948514 missense probably damaging 0.96
R2041:Olfr574 UTSW 7 102948963 missense probably damaging 0.98
R2079:Olfr574 UTSW 7 102949495 missense probably benign 0.00
R2261:Olfr574 UTSW 7 102949257 missense probably damaging 1.00
R2263:Olfr574 UTSW 7 102949257 missense probably damaging 1.00
R2513:Olfr574 UTSW 7 102949493 missense probably benign
R2903:Olfr574 UTSW 7 102949454 missense probably benign 0.05
R4445:Olfr574 UTSW 7 102948798 missense possibly damaging 0.93
R4512:Olfr574 UTSW 7 102948738 missense probably damaging 1.00
R4513:Olfr574 UTSW 7 102948738 missense probably damaging 1.00
R4528:Olfr574 UTSW 7 102948806 missense probably damaging 1.00
R4904:Olfr574 UTSW 7 102949065 missense probably damaging 1.00
R5935:Olfr574 UTSW 7 102948810 missense probably benign 0.01
R6784:Olfr574 UTSW 7 102948515 missense possibly damaging 0.91
R7082:Olfr574 UTSW 7 102949248 missense probably damaging 1.00
R7125:Olfr574 UTSW 7 102949179 missense probably damaging 0.99
R7549:Olfr574 UTSW 7 102948591 missense possibly damaging 0.92
R7564:Olfr574 UTSW 7 102949266 missense probably damaging 1.00
R7947:Olfr574 UTSW 7 102949071 missense probably damaging 1.00
R8460:Olfr574 UTSW 7 102949324 nonsense probably null
R8518:Olfr574 UTSW 7 102948597 missense probably damaging 1.00
R8859:Olfr574 UTSW 7 102949166 missense probably damaging 1.00
R9116:Olfr574 UTSW 7 102949320 missense possibly damaging 0.87
R9327:Olfr574 UTSW 7 102948480 missense probably benign 0.00
R9408:Olfr574 UTSW 7 102949236 missense probably damaging 1.00
Z1177:Olfr574 UTSW 7 102948752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTCTACACCATTGCAC -3'
(R):5'- TGGAAGGACACACTCTTCAC -3'

Sequencing Primer
(F):5'- CCATTGCACTCTTAGGAAACAG -3'
(R):5'- TGTCTTATACAGATGATCAGTCCG -3'
Posted On 2018-10-18