Incidental Mutation 'R6889:Ppfibp2'
ID 537110
Institutional Source Beutler Lab
Gene Symbol Ppfibp2
Ensembl Gene ENSMUSG00000036528
Gene Name PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms Cclp1, liprin beta 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107595207-107748583 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 107737981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 591 (D591A)
Ref Sequence ENSEMBL: ENSMUSP00000095738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040056] [ENSMUST00000098134] [ENSMUST00000208159]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040056
AA Change: D602A

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042574
Gene: ENSMUSG00000036528
AA Change: D602A

DomainStartEndE-ValueType
Pfam:Integrase_DNA 192 256 3.4e-24 PFAM
low complexity region 357 374 N/A INTRINSIC
SAM 561 628 1.86e-12 SMART
SAM 633 699 4.07e-9 SMART
SAM 721 793 9.22e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098134
AA Change: D591A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095738
Gene: ENSMUSG00000036528
AA Change: D591A

DomainStartEndE-ValueType
PDB:3QH9|A 185 265 2e-26 PDB
low complexity region 357 374 N/A INTRINSIC
SAM 550 617 1.86e-12 SMART
SAM 622 688 4.07e-9 SMART
SAM 710 782 9.22e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208159
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. The encoded protein is a beta liprin and plays a role in axon guidance and neuronal synapse development by recruiting LAR protein-tyrosine phosphatases to the plasma membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Ppfibp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ppfibp2 APN 7 107708805 missense probably damaging 1.00
IGL00429:Ppfibp2 APN 7 107697594 missense probably benign 0.18
IGL00785:Ppfibp2 APN 7 107737887 missense probably benign
IGL00821:Ppfibp2 APN 7 107729876 missense probably damaging 1.00
IGL01295:Ppfibp2 APN 7 107747539 unclassified probably benign
IGL01361:Ppfibp2 APN 7 107744301 splice site probably null
IGL02115:Ppfibp2 APN 7 107739318 unclassified probably benign
IGL02323:Ppfibp2 APN 7 107738629 missense probably damaging 1.00
IGL02458:Ppfibp2 APN 7 107742964 missense probably damaging 1.00
IGL02731:Ppfibp2 APN 7 107746422 missense possibly damaging 0.92
IGL03343:Ppfibp2 APN 7 107737919 nonsense probably null
R0142:Ppfibp2 UTSW 7 107744177 missense probably damaging 1.00
R0555:Ppfibp2 UTSW 7 107729174 missense probably damaging 1.00
R0630:Ppfibp2 UTSW 7 107738599 critical splice acceptor site probably null
R1374:Ppfibp2 UTSW 7 107685988 splice site probably benign
R1668:Ppfibp2 UTSW 7 107729892 missense probably damaging 1.00
R1731:Ppfibp2 UTSW 7 107740589 missense probably damaging 1.00
R1830:Ppfibp2 UTSW 7 107637297 missense probably damaging 1.00
R1902:Ppfibp2 UTSW 7 107746378 missense probably damaging 1.00
R2061:Ppfibp2 UTSW 7 107739230 missense probably damaging 1.00
R2929:Ppfibp2 UTSW 7 107697651 missense probably damaging 0.99
R3777:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R3778:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R4839:Ppfibp2 UTSW 7 107742985 missense probably damaging 1.00
R4879:Ppfibp2 UTSW 7 107729183 missense probably benign 0.01
R5643:Ppfibp2 UTSW 7 107737890 missense probably damaging 1.00
R5773:Ppfibp2 UTSW 7 107685872 missense possibly damaging 0.74
R6255:Ppfibp2 UTSW 7 107681762 missense probably damaging 0.96
R6356:Ppfibp2 UTSW 7 107681769 missense probably benign 0.01
R6843:Ppfibp2 UTSW 7 107727731 missense probably benign 0.00
R7051:Ppfibp2 UTSW 7 107717718 missense probably damaging 1.00
R7194:Ppfibp2 UTSW 7 107722980 critical splice donor site probably null
R7654:Ppfibp2 UTSW 7 107738611 missense probably damaging 0.99
R7678:Ppfibp2 UTSW 7 107716666 missense probably damaging 0.98
R7895:Ppfibp2 UTSW 7 107721317 splice site probably null
R8385:Ppfibp2 UTSW 7 107697687 missense probably benign 0.44
R8434:Ppfibp2 UTSW 7 107728750 critical splice donor site probably null
R8691:Ppfibp2 UTSW 7 107747578 missense probably damaging 0.99
R8695:Ppfibp2 UTSW 7 107685856 splice site probably benign
R8700:Ppfibp2 UTSW 7 107746395 missense possibly damaging 0.94
R8755:Ppfibp2 UTSW 7 107744225 missense probably damaging 1.00
R9172:Ppfibp2 UTSW 7 107738318 nonsense probably null
R9182:Ppfibp2 UTSW 7 107708846 missense possibly damaging 0.72
R9355:Ppfibp2 UTSW 7 107722962 missense probably benign 0.00
R9545:Ppfibp2 UTSW 7 107738297 missense probably damaging 1.00
RF022:Ppfibp2 UTSW 7 107697610 missense probably damaging 1.00
Z1177:Ppfibp2 UTSW 7 107743050 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTGCTATGCAAAGTCCTGGG -3'
(R):5'- GTCAGGATAGAGATGCTCTTGAG -3'

Sequencing Primer
(F):5'- GCGTATGTACATGGATGG -3'
(R):5'- CTGCGGTAGGTGCACAGAG -3'
Posted On 2018-10-18