Incidental Mutation 'R6889:Pdpr'
ID 537114
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Name pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms 4930402E16Rik
MMRRC Submission 044983-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111094630-111137074 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 111124613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000144377]
AlphaFold Q7TSQ8
Predicted Effect probably null
Transcript: ENSMUST00000039333
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144377
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111102072 missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111112710 missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111121278 splice site probably null
IGL01681:Pdpr APN 8 111132936 missense probably damaging 1.00
IGL01785:Pdpr APN 8 111129656 missense probably damaging 0.98
IGL02115:Pdpr APN 8 111103998 missense probably damaging 1.00
IGL02292:Pdpr APN 8 111125680 missense probably damaging 1.00
IGL02749:Pdpr APN 8 111118090 missense probably benign 0.01
IGL03296:Pdpr APN 8 111114798 missense probably damaging 1.00
R0730:Pdpr UTSW 8 111125755 critical splice donor site probably null
R1510:Pdpr UTSW 8 111124475 splice site probably benign
R1837:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R1838:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R2144:Pdpr UTSW 8 111118036 missense probably damaging 0.97
R4214:Pdpr UTSW 8 111129580 intron probably benign
R4812:Pdpr UTSW 8 111116717 missense probably benign 0.00
R4863:Pdpr UTSW 8 111101951 missense probably benign 0.01
R4998:Pdpr UTSW 8 111114768 missense probably damaging 1.00
R5579:Pdpr UTSW 8 111123816 missense probably damaging 1.00
R5665:Pdpr UTSW 8 111114811 missense possibly damaging 0.55
R5739:Pdpr UTSW 8 111134620 missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111101900 nonsense probably null
R6785:Pdpr UTSW 8 111124611 missense probably benign 0.00
R7397:Pdpr UTSW 8 111112753 missense possibly damaging 0.73
R7543:Pdpr UTSW 8 111132888 missense probably damaging 1.00
R7634:Pdpr UTSW 8 111125685 missense probably damaging 1.00
R8683:Pdpr UTSW 8 111123860 missense probably damaging 1.00
R8794:Pdpr UTSW 8 111125608 missense possibly damaging 0.53
R8833:Pdpr UTSW 8 111125680 missense probably damaging 1.00
R9283:Pdpr UTSW 8 111129636 missense possibly damaging 0.62
R9487:Pdpr UTSW 8 111126293 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAACTCTTTACTTTCCACCGTGTT -3'
(R):5'- CTTCCAGAATCAGTTTTGAGGTAAT -3'

Sequencing Primer
(F):5'- TTTTTCTGCTTCATAGACCTTCTTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On 2018-10-18