Incidental Mutation 'R6889:Nrp1'
ID537115
Institutional Source Beutler Lab
Gene Symbol Nrp1
Ensembl Gene ENSMUSG00000025810
Gene Nameneuropilin 1
SynonymsNeuropilin-1, NP-1, NPN-1, Npn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location128358604-128503363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128493057 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 652 (F652S)
Ref Sequence ENSEMBL: ENSMUSP00000026917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026917]
PDB Structure Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026917
AA Change: F652S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: F652S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CUB 27 141 1.44e-43 SMART
CUB 147 265 9.19e-42 SMART
FA58C 274 424 5.21e-44 SMART
FA58C 430 583 4.15e-20 SMART
low complexity region 587 599 N/A INTRINSIC
MAM 645 811 4.94e-69 SMART
Pfam:DUF3481 837 920 3.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Nrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Nrp1 APN 8 128476207 missense probably benign
IGL01412:Nrp1 APN 8 128418707 splice site probably benign
IGL01586:Nrp1 APN 8 128432032 missense possibly damaging 0.86
IGL02307:Nrp1 APN 8 128502720 missense probably damaging 1.00
IGL02500:Nrp1 APN 8 128425799 missense possibly damaging 0.94
IGL02547:Nrp1 APN 8 128493031 missense probably benign
R0046:Nrp1 UTSW 8 128500608 splice site probably benign
R0281:Nrp1 UTSW 8 128460683 missense probably damaging 0.96
R0403:Nrp1 UTSW 8 128457969 missense probably damaging 1.00
R0610:Nrp1 UTSW 8 128502618 missense probably damaging 1.00
R1055:Nrp1 UTSW 8 128468598 missense possibly damaging 0.68
R1229:Nrp1 UTSW 8 128418716 nonsense probably null
R1263:Nrp1 UTSW 8 128468389 missense probably damaging 1.00
R1340:Nrp1 UTSW 8 128434355 missense probably damaging 1.00
R1397:Nrp1 UTSW 8 128418716 nonsense probably null
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1462:Nrp1 UTSW 8 128502798 missense probably benign
R1531:Nrp1 UTSW 8 128425969 missense probably null 0.19
R1587:Nrp1 UTSW 8 128476282 missense probably damaging 1.00
R1719:Nrp1 UTSW 8 128425885 missense probably damaging 1.00
R1733:Nrp1 UTSW 8 128468493 missense probably benign 0.02
R1785:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R1786:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2047:Nrp1 UTSW 8 128498096 splice site probably benign
R2130:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2132:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2133:Nrp1 UTSW 8 128498516 missense probably damaging 1.00
R2163:Nrp1 UTSW 8 128497871 missense probably damaging 1.00
R2338:Nrp1 UTSW 8 128497904 missense probably benign 0.01
R2407:Nrp1 UTSW 8 128431945 missense probably damaging 0.99
R3405:Nrp1 UTSW 8 128498088 nonsense probably null
R3748:Nrp1 UTSW 8 128457980 missense probably damaging 1.00
R4347:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R4379:Nrp1 UTSW 8 128468467 missense probably damaging 1.00
R4646:Nrp1 UTSW 8 128457944 missense probably benign 0.00
R4688:Nrp1 UTSW 8 128502566 missense probably benign 0.01
R4916:Nrp1 UTSW 8 128502804 nonsense probably null
R5077:Nrp1 UTSW 8 128500673 critical splice donor site probably null
R5301:Nrp1 UTSW 8 128434197 splice site probably null
R5509:Nrp1 UTSW 8 128425915 missense possibly damaging 0.73
R5745:Nrp1 UTSW 8 128468448 missense probably benign 0.22
R5873:Nrp1 UTSW 8 128468377 missense probably damaging 1.00
R5987:Nrp1 UTSW 8 128476169 missense probably damaging 1.00
R6060:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
R6757:Nrp1 UTSW 8 128425868 missense probably damaging 1.00
R7025:Nrp1 UTSW 8 128480954 missense probably damaging 1.00
R7065:Nrp1 UTSW 8 128460712 missense probably benign
R7290:Nrp1 UTSW 8 128476296 critical splice donor site probably null
R7369:Nrp1 UTSW 8 128431915 missense probably damaging 1.00
R7553:Nrp1 UTSW 8 128431987 missense probably damaging 1.00
R7650:Nrp1 UTSW 8 128498014 missense possibly damaging 0.87
R8043:Nrp1 UTSW 8 128432023 missense probably benign 0.00
R8088:Nrp1 UTSW 8 128468516 nonsense probably null
R8193:Nrp1 UTSW 8 128460706 missense probably damaging 1.00
R8206:Nrp1 UTSW 8 128457957 missense probably damaging 0.99
R8245:Nrp1 UTSW 8 128487953 missense probably benign
R8684:Nrp1 UTSW 8 128359404 start gained probably benign
R8734:Nrp1 UTSW 8 128480939 missense probably benign 0.23
R8875:Nrp1 UTSW 8 128480991 critical splice donor site probably null
R9054:Nrp1 UTSW 8 128487908 missense probably benign
X0066:Nrp1 UTSW 8 128460645 missense possibly damaging 0.95
Z1186:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1189:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Z1192:Nrp1 UTSW 8 128497938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAAGGTGGACCCAAAACAG -3'
(R):5'- TAGGAAGGCCAACCCATAGC -3'

Sequencing Primer
(F):5'- AACATTTTTGGCATGTTCATGC -3'
(R):5'- CACTCTTACCTGTATGGTCC -3'
Posted On2018-10-18