Incidental Mutation 'R6889:Rai1'
ID537124
Institutional Source Beutler Lab
Gene Symbol Rai1
Ensembl Gene ENSMUSG00000062115
Gene Nameretinoic acid induced 1
SynonymsGt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6889 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60105013-60199197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60185715 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 202 (F202L)
Ref Sequence ENSEMBL: ENSMUSP00000126183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064190] [ENSMUST00000090806] [ENSMUST00000102688] [ENSMUST00000132012] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000064190
AA Change: F202L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090806
AA Change: F202L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088315
Gene: ENSMUSG00000062115
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102688
AA Change: F202L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132012
SMART Domains Protein: ENSMUSP00000118543
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171108
AA Change: F202L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die as embryos. Survivors have shortened life spans and show severe craniofacial and axial skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Snx4 G T 16: 33,251,470 A4S possibly damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Rai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Rai1 APN 11 60185391 missense probably damaging 1.00
IGL00952:Rai1 APN 11 60187992 nonsense probably null
IGL01118:Rai1 APN 11 60187438 missense probably damaging 0.98
IGL02540:Rai1 APN 11 60186924 missense probably benign 0.09
IGL02624:Rai1 APN 11 60188743 missense probably damaging 1.00
IGL02696:Rai1 APN 11 60193956 missense probably benign
IGL02940:Rai1 APN 11 60187018 missense probably benign 0.03
IGL02970:Rai1 APN 11 60185733 missense probably damaging 1.00
IGL03006:Rai1 APN 11 60188205 missense possibly damaging 0.95
R0557:Rai1 UTSW 11 60190495 missense probably benign 0.00
R1438:Rai1 UTSW 11 60185395 missense probably benign 0.00
R1712:Rai1 UTSW 11 60187602 missense probably benign
R1837:Rai1 UTSW 11 60189398 missense probably damaging 1.00
R1899:Rai1 UTSW 11 60185920 missense probably benign 0.16
R2024:Rai1 UTSW 11 60185589 missense probably damaging 0.99
R2141:Rai1 UTSW 11 60189467 missense possibly damaging 0.94
R2168:Rai1 UTSW 11 60187596 missense probably benign 0.01
R2404:Rai1 UTSW 11 60189924 missense probably benign
R4869:Rai1 UTSW 11 60186762 missense probably damaging 1.00
R4894:Rai1 UTSW 11 60186746 missense probably damaging 1.00
R5082:Rai1 UTSW 11 60185919 missense possibly damaging 0.48
R5093:Rai1 UTSW 11 60188656 missense probably benign 0.00
R5221:Rai1 UTSW 11 60190597 missense probably damaging 1.00
R5503:Rai1 UTSW 11 60186453 missense probably benign 0.00
R5587:Rai1 UTSW 11 60189859 missense probably damaging 1.00
R5849:Rai1 UTSW 11 60190521 missense possibly damaging 0.90
R5914:Rai1 UTSW 11 60187804 missense probably benign
R5950:Rai1 UTSW 11 60187593 missense probably damaging 1.00
R6111:Rai1 UTSW 11 60187906 missense probably damaging 0.99
R6450:Rai1 UTSW 11 60186603 missense probably benign 0.30
R6785:Rai1 UTSW 11 60188794 missense probably benign
R7296:Rai1 UTSW 11 60188673 missense probably benign 0.39
R7388:Rai1 UTSW 11 60189375 missense possibly damaging 0.46
R8196:Rai1 UTSW 11 60185970 missense probably damaging 1.00
X0018:Rai1 UTSW 11 60186436 missense probably benign 0.03
X0019:Rai1 UTSW 11 60189940 missense probably benign 0.14
X0024:Rai1 UTSW 11 60187395 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGTTGTGCCTCCTCCAAAC -3'
(R):5'- CTTGAAGTGCTTGCTGCTGC -3'

Sequencing Primer
(F):5'- TGCCTCCTCCAAACAGGCAG -3'
(R):5'- TAAGCGTGAAGATTCTGGACCC -3'
Posted On2018-10-18