Mutagenetix > Incidental Mutation

Incidental Mutation 'R6889:Atp6v0a1'

537127

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a1

Ensembl Gene

ENSMUSG00000019302

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A1

Synonyms

Atp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1

MMRRC Submission

044983-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6889 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101009452-101063719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101029183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 214 (Y214C)

Ref Sequence

ENSEMBL: ENSMUSP00000131848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]

AlphaFold

Q9Z1G4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044721
AA Change: Y214C

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: Y214C

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092663
AA Change: Y214C

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: Y214C

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	823	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103110
AA Change: Y221C

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: Y221C

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	829	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168757
AA Change: Y214C

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: Y214C

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,943,053	D103E	probably benign	Het
Abcc3	A	T	11: 94,375,555	S70T	possibly damaging	Het
Azi2	A	G	9: 118,049,895		probably null	Het
BC067074	C	A	13: 113,318,378	S319R	probably damaging	Het
Cacnb2	T	A	2: 14,986,015	V636E	possibly damaging	Het
Cd8a	A	C	6: 71,374,562	T169P	probably damaging	Het
Cfap44	G	A	16: 44,404,132	V68I	probably benign	Het
Eea1	G	T	10: 96,037,478	C1134F	probably benign	Het
Ehmt2	T	G	17: 34,912,772	F1192V	probably damaging	Het
Emc1	T	C	4: 139,365,350	F531L	probably damaging	Het
Eme1	G	A	11: 94,650,477	T173I	probably benign	Het
Gli2	A	T	1: 118,844,416	C520S	probably damaging	Het
Gm43302	T	C	5: 105,280,138	K186E	probably benign	Het
Gpr108	A	T	17: 57,236,990	N405K	probably damaging	Het
Hmgcl	C	A	4: 135,955,642	T135N	probably benign	Het
Hydin	G	A	8: 110,532,856	D2487N	possibly damaging	Het
Igfl3	G	T	7: 18,179,800	R25L	probably benign	Het
Igsf10	A	C	3: 59,331,933	S276A	probably benign	Het
Kctd1	A	G	18: 14,973,988	S211P	probably damaging	Het
Kctd7	A	T	5: 130,152,501	Q255L	probably benign	Het
Lrig1	A	G	6: 94,625,063	Y270H	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	G	16: 49,153,111	N1248S	possibly damaging	Het
Nod1	A	G	6: 54,944,109	F408S	probably benign	Het
Nrp1	T	C	8: 128,493,057	F652S	probably damaging	Het
Olfr1338	G	A	4: 118,754,307	T79I	probably damaging	Het
Olfr487	A	T	7: 108,211,918	F204I	probably benign	Het
Olfr574	A	T	7: 102,948,768	H91L	possibly damaging	Het
Olfr821	T	C	10: 130,034,532	M302T	probably benign	Het
Opa1	G	T	16: 29,620,868	R792L	probably benign	Het
Pcdha6	G	T	18: 36,968,343	L196F	probably damaging	Het
Pdia2	A	T	17: 26,196,970	Y347*	probably null	Het
Pdpr	G	T	8: 111,124,613		probably null	Het
Pigt	T	A	2: 164,507,331	L518Q	probably damaging	Het
Ppfibp2	A	C	7: 107,737,981	D591A	possibly damaging	Het
Prrg2	G	A	7: 45,059,989	T97M	possibly damaging	Het
Qars	A	G	9: 108,513,183	T428A	probably damaging	Het
Rai1	T	C	11: 60,185,715	F202L	probably damaging	Het
Rars	A	T	11: 35,808,486	M660K	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a6	A	C	11: 109,455,040	F382V	probably damaging	Het
Slc30a7	T	C	3: 115,954,153	T330A	probably damaging	Het
Smc1b	A	T	15: 85,067,759	L1157Q	probably damaging	Het
Snx4	G	T	16: 33,251,470	A4S	possibly damaging	Het
Sv2b	A	C	7: 75,125,767		probably null	Het
Syt9	A	T	7: 107,425,286	I129L	probably damaging	Het
Ttbk2	T	C	2: 120,773,353	E198G	probably damaging	Het
Ubr3	A	T	2: 69,944,300	D488V	possibly damaging	Het
Ush2a	T	A	1: 188,797,871	C3286S	probably damaging	Het
Vill	A	G	9: 119,065,882	D56G	possibly damaging	Het
Vmn1r41	A	T	6: 89,747,370	I298F	probably damaging	Het
Vmn2r2	A	T	3: 64,117,267	V631D	probably damaging	Het
Vmn2r32	A	G	7: 7,472,574	S437P	possibly damaging	Het
Vmn2r53	A	G	7: 12,601,142	V197A	probably benign	Het
Wasf1	A	T	10: 40,920,369	I32F	probably damaging	Het
Wasf2	G	T	4: 133,194,730	A387S	unknown	Het
Wdr92	G	A	11: 17,222,309	V133M	probably damaging	Het
Zbtb14	G	A	17: 69,387,679	C124Y	probably damaging	Het
Zfp462	G	T	4: 55,007,671	A37S	probably damaging	Het
Zfp532	A	G	18: 65,686,990	E882G	possibly damaging	Het

Other mutations in Atp6v0a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Atp6v0a1	APN	11	101030505	critical splice donor site	probably null
IGL01024:Atp6v0a1	APN	11	101048439	missense	probably benign	0.00
IGL01390:Atp6v0a1	APN	11	101043802	missense	probably benign	0.01
IGL02214:Atp6v0a1	APN	11	101039840	missense	probably benign	0.01
IGL02639:Atp6v0a1	APN	11	101055518	missense	possibly damaging	0.90
R0125:Atp6v0a1	UTSW	11	101038851	splice site	probably null
R0193:Atp6v0a1	UTSW	11	101048482	missense	possibly damaging	0.90
R0265:Atp6v0a1	UTSW	11	101048515	missense	possibly damaging	0.80
R0973:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R0973:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R0974:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R1460:Atp6v0a1	UTSW	11	101033998	missense	probably damaging	1.00
R1580:Atp6v0a1	UTSW	11	101029204	missense	probably damaging	1.00
R1625:Atp6v0a1	UTSW	11	101055554	missense	probably damaging	1.00
R1644:Atp6v0a1	UTSW	11	101038786	missense	possibly damaging	0.65
R1779:Atp6v0a1	UTSW	11	101026685	missense	probably benign	0.01
R2895:Atp6v0a1	UTSW	11	101044598	missense	probably benign
R2926:Atp6v0a1	UTSW	11	101043948	missense	probably damaging	0.99
R3727:Atp6v0a1	UTSW	11	101030420	missense	probably benign	0.01
R3943:Atp6v0a1	UTSW	11	101055517	missense	probably benign	0.00
R4820:Atp6v0a1	UTSW	11	101042950	missense	probably benign	0.00
R5119:Atp6v0a1	UTSW	11	101020515	missense	probably benign	0.02
R5250:Atp6v0a1	UTSW	11	101043044	missense	possibly damaging	0.94
R5377:Atp6v0a1	UTSW	11	101055587	missense	probably damaging	1.00
R5393:Atp6v0a1	UTSW	11	101038807	missense	possibly damaging	0.95
R5497:Atp6v0a1	UTSW	11	101029185	missense	probably damaging	1.00
R5787:Atp6v0a1	UTSW	11	101018574	missense	probably benign	0.04
R6054:Atp6v0a1	UTSW	11	101039889	missense	possibly damaging	0.91
R6076:Atp6v0a1	UTSW	11	101055060	missense	probably damaging	1.00
R7035:Atp6v0a1	UTSW	11	101027357	missense	probably damaging	0.97
R7084:Atp6v0a1	UTSW	11	101034042	missense	probably damaging	1.00
R7212:Atp6v0a1	UTSW	11	101043957	missense	probably benign	0.08
R8289:Atp6v0a1	UTSW	11	101034105	missense	probably damaging	1.00
R8461:Atp6v0a1	UTSW	11	101044574	missense	possibly damaging	0.60
R8680:Atp6v0a1	UTSW	11	101062403	makesense	probably null
R8725:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8727:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8935:Atp6v0a1	UTSW	11	101038693	missense	possibly damaging	0.90
R9658:Atp6v0a1	UTSW	11	101018588	missense	probably benign	0.18
R9762:Atp6v0a1	UTSW	11	101055601	missense	possibly damaging	0.46
R9779:Atp6v0a1	UTSW	11	101034112	missense	probably damaging	1.00
X0023:Atp6v0a1	UTSW	11	101044597	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATTCGTTCTGATGCCACCCAAG -3'
(R):5'- TCCCAGTGAAAGCAGAACTGAG -3'

Sequencing Primer
(F):5'- CTTTAAAGCTAGGCCTGTAAGC -3'
(R):5'- AACTGAGGGATCTGCAGGCC -3'

Posted On

2018-10-18