Mutagenetix > Incidental Mutation

Incidental Mutation 'R6889:BC067074'

537129

Institutional Source

Beutler Lab

Gene Symbol

BC067074

Ensembl Gene

ENSMUSG00000021763

Gene Name

cDNA sequence BC067074

Synonyms

MMRRC Submission

044983-MU

Accession Numbers

Ncbi RefSeq: none; VEGA: OTTMUST00000084794; MGI:3040697

Essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R6889 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

113293159-113379711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 113318378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 319 (S319R)

Ref Sequence

ENSEMBL: ENSMUSP00000119993 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000136755]

AlphaFold

F6RXI4

Predicted Effect

probably damaging
Transcript: ENSMUST00000136755
AA Change: S319R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119993
Gene: ENSMUSG00000021763
AA Change: S319R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LamG	44	177	1.28e-20	SMART
LamG	229	371	4.66e-14	SMART
low complexity region	407	420	N/A	INTRINSIC
Pfam:Cadherin_3	492	644	2.1e-35	PFAM
Pfam:Cadherin_3	647	759	1e-7	PFAM
Pfam:Cadherin_3	741	873	1.2e-8	PFAM
Pfam:Cadherin_3	861	989	4.1e-14	PFAM
Pfam:Cadherin_3	958	1114	1.2e-20	PFAM
Pfam:Cadherin_3	1117	1223	1.6e-10	PFAM
Pfam:Cadherin_3	1212	1341	5.6e-12	PFAM
Pfam:Cadherin_3	1347	1438	3.8e-8	PFAM
Pfam:Cadherin_3	1419	1562	2.3e-45	PFAM
Pfam:Cadherin_3	1576	1679	2.1e-9	PFAM
low complexity region	1732	1740	N/A	INTRINSIC
Pfam:Cadherin_3	1773	1926	3e-35	PFAM
transmembrane domain	2267	2289	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,943,053	D103E	probably benign	Het
Abcc3	A	T	11: 94,375,555	S70T	possibly damaging	Het
Atp6v0a1	A	G	11: 101,029,183	Y214C	possibly damaging	Het
Azi2	A	G	9: 118,049,895		probably null	Het
Cacnb2	T	A	2: 14,986,015	V636E	possibly damaging	Het
Cd8a	A	C	6: 71,374,562	T169P	probably damaging	Het
Cfap44	G	A	16: 44,404,132	V68I	probably benign	Het
Eea1	G	T	10: 96,037,478	C1134F	probably benign	Het
Ehmt2	T	G	17: 34,912,772	F1192V	probably damaging	Het
Emc1	T	C	4: 139,365,350	F531L	probably damaging	Het
Eme1	G	A	11: 94,650,477	T173I	probably benign	Het
Gli2	A	T	1: 118,844,416	C520S	probably damaging	Het
Gm43302	T	C	5: 105,280,138	K186E	probably benign	Het
Gpr108	A	T	17: 57,236,990	N405K	probably damaging	Het
Hmgcl	C	A	4: 135,955,642	T135N	probably benign	Het
Hydin	G	A	8: 110,532,856	D2487N	possibly damaging	Het
Igfl3	G	T	7: 18,179,800	R25L	probably benign	Het
Igsf10	A	C	3: 59,331,933	S276A	probably benign	Het
Kctd1	A	G	18: 14,973,988	S211P	probably damaging	Het
Kctd7	A	T	5: 130,152,501	Q255L	probably benign	Het
Lrig1	A	G	6: 94,625,063	Y270H	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	G	16: 49,153,111	N1248S	possibly damaging	Het
Nod1	A	G	6: 54,944,109	F408S	probably benign	Het
Nrp1	T	C	8: 128,493,057	F652S	probably damaging	Het
Olfr1338	G	A	4: 118,754,307	T79I	probably damaging	Het
Olfr487	A	T	7: 108,211,918	F204I	probably benign	Het
Olfr574	A	T	7: 102,948,768	H91L	possibly damaging	Het
Olfr821	T	C	10: 130,034,532	M302T	probably benign	Het
Opa1	G	T	16: 29,620,868	R792L	probably benign	Het
Pcdha6	G	T	18: 36,968,343	L196F	probably damaging	Het
Pdia2	A	T	17: 26,196,970	Y347*	probably null	Het
Pdpr	G	T	8: 111,124,613		probably null	Het
Pigt	T	A	2: 164,507,331	L518Q	probably damaging	Het
Ppfibp2	A	C	7: 107,737,981	D591A	possibly damaging	Het
Prrg2	G	A	7: 45,059,989	T97M	possibly damaging	Het
Qars	A	G	9: 108,513,183	T428A	probably damaging	Het
Rai1	T	C	11: 60,185,715	F202L	probably damaging	Het
Rars	A	T	11: 35,808,486	M660K	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a6	A	C	11: 109,455,040	F382V	probably damaging	Het
Slc30a7	T	C	3: 115,954,153	T330A	probably damaging	Het
Smc1b	A	T	15: 85,067,759	L1157Q	probably damaging	Het
Snx4	G	T	16: 33,251,470	A4S	possibly damaging	Het
Sv2b	A	C	7: 75,125,767		probably null	Het
Syt9	A	T	7: 107,425,286	I129L	probably damaging	Het
Ttbk2	T	C	2: 120,773,353	E198G	probably damaging	Het
Ubr3	A	T	2: 69,944,300	D488V	possibly damaging	Het
Ush2a	T	A	1: 188,797,871	C3286S	probably damaging	Het
Vill	A	G	9: 119,065,882	D56G	possibly damaging	Het
Vmn1r41	A	T	6: 89,747,370	I298F	probably damaging	Het
Vmn2r2	A	T	3: 64,117,267	V631D	probably damaging	Het
Vmn2r32	A	G	7: 7,472,574	S437P	possibly damaging	Het
Vmn2r53	A	G	7: 12,601,142	V197A	probably benign	Het
Wasf1	A	T	10: 40,920,369	I32F	probably damaging	Het
Wasf2	G	T	4: 133,194,730	A387S	unknown	Het
Wdr92	G	A	11: 17,222,309	V133M	probably damaging	Het
Zbtb14	G	A	17: 69,387,679	C124Y	probably damaging	Het
Zfp462	G	T	4: 55,007,671	A37S	probably damaging	Het
Zfp532	A	G	18: 65,686,990	E882G	possibly damaging	Het

Other mutations in BC067074

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:BC067074	APN	13	113367557	missense	possibly damaging	0.91
IGL03023:BC067074	APN	13	113351741	missense	probably benign	0.03
cumpleanos	UTSW	13	113368336	missense	possibly damaging	0.87
Sorpresa	UTSW	13	113318191	missense	probably damaging	1.00
P0018:BC067074	UTSW	13	113367506	missense	possibly damaging	0.60
R0003:BC067074	UTSW	13	113368776	missense	probably benign	0.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0016:BC067074	UTSW	13	113366105	missense	probably damaging	1.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0053:BC067074	UTSW	13	113368489	missense	probably benign	0.00
R0158:BC067074	UTSW	13	113369153	nonsense	probably null
R0281:BC067074	UTSW	13	113369143	missense	probably damaging	1.00
R1212:BC067074	UTSW	13	113369417	intron	probably benign
R1300:BC067074	UTSW	13	113366160	missense	probably damaging	1.00
R1434:BC067074	UTSW	13	113368492	missense	possibly damaging	0.46
R1509:BC067074	UTSW	13	113368256	missense	probably damaging	0.99
R1738:BC067074	UTSW	13	113367500	missense	possibly damaging	0.69
R1758:BC067074	UTSW	13	113368732	missense	possibly damaging	0.78
R1828:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R2061:BC067074	UTSW	13	113318094	missense	probably damaging	0.99
R2570:BC067074	UTSW	13	113318587	missense	probably benign	0.34
R2884:BC067074	UTSW	13	113320682	missense	probably damaging	1.00
R2884:BC067074	UTSW	13	113369191	missense	probably benign	0.00
R3004:BC067074	UTSW	13	113366154	missense	probably damaging	1.00
R3150:BC067074	UTSW	13	113351760	missense	probably damaging	1.00
R3773:BC067074	UTSW	13	113318209	missense	probably benign	0.12
R3864:BC067074	UTSW	13	113322951	missense	possibly damaging	0.64
R3971:BC067074	UTSW	13	113317126	missense	probably damaging	1.00
R4004:BC067074	UTSW	13	113318380	missense	probably benign	0.00
R4271:BC067074	UTSW	13	113342370	missense	possibly damaging	0.76
R4382:BC067074	UTSW	13	113322754	missense	probably benign	0.10
R4484:BC067074	UTSW	13	113319199	missense	probably damaging	0.98
R4570:BC067074	UTSW	13	113318191	missense	probably damaging	1.00
R4600:BC067074	UTSW	13	113319249	missense	possibly damaging	0.95
R4622:BC067074	UTSW	13	113320081	missense	probably benign	0.00
R4676:BC067074	UTSW	13	113368807	missense	probably damaging	0.98
R4676:BC067074	UTSW	13	113368808	missense	probably damaging	1.00
R4677:BC067074	UTSW	13	113379486	missense	unknown
R4775:BC067074	UTSW	13	113317695	missense	possibly damaging	0.91
R4779:BC067074	UTSW	13	113368336	missense	possibly damaging	0.87
R4780:BC067074	UTSW	13	113317858	missense	probably damaging	1.00
R4829:BC067074	UTSW	13	113368162	missense	probably benign	0.05
R4841:BC067074	UTSW	13	113366190	missense	probably benign	0.00
R4879:BC067074	UTSW	13	113319787	missense	probably benign	0.03
R4930:BC067074	UTSW	13	113327662	missense	probably damaging	1.00
R4934:BC067074	UTSW	13	113368348	missense	probably damaging	1.00
R4987:BC067074	UTSW	13	113318101	missense	probably benign	0.07
R5065:BC067074	UTSW	13	113320919	missense	probably benign	0.01
R5216:BC067074	UTSW	13	113342413	missense	probably benign	0.20
R5236:BC067074	UTSW	13	113366220	missense	probably benign	0.14
R5247:BC067074	UTSW	13	113319459	missense	probably damaging	1.00
R5250:BC067074	UTSW	13	113319771	missense	possibly damaging	0.95
R5337:BC067074	UTSW	13	113318765	missense	probably damaging	1.00
R5342:BC067074	UTSW	13	113366269	critical splice donor site	probably null
R5426:BC067074	UTSW	13	113369053	missense	probably benign	0.01
R5472:BC067074	UTSW	13	113319169	missense	probably benign	0.12
R5526:BC067074	UTSW	13	113367893	missense	probably benign	0.22
R5543:BC067074	UTSW	13	113320873	missense	probably damaging	0.96
R5589:BC067074	UTSW	13	113317950	missense	possibly damaging	0.95
R5623:BC067074	UTSW	13	113346634	missense	possibly damaging	0.95
R5668:BC067074	UTSW	13	113317167	missense	possibly damaging	0.55
R5793:BC067074	UTSW	13	113321022	missense	possibly damaging	0.75
R5824:BC067074	UTSW	13	113368620	missense	probably damaging	1.00
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6038:BC067074	UTSW	13	113318619	missense	possibly damaging	0.49
R6053:BC067074	UTSW	13	113320726	missense	possibly damaging	0.51
R6125:BC067074	UTSW	13	113317683	missense	probably benign	0.00
R6129:BC067074	UTSW	13	113368806	nonsense	probably null
R6290:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6291:BC067074	UTSW	13	113320447	missense	possibly damaging	0.85
R6302:BC067074	UTSW	13	113368112	missense	probably damaging	1.00
R6317:BC067074	UTSW	13	113368268	missense	probably benign	0.09
R6395:BC067074	UTSW	13	113369469	missense	probably damaging	1.00
R6673:BC067074	UTSW	13	113367832	nonsense	probably null
R6783:BC067074	UTSW	13	113320209	nonsense	probably null
R6800:BC067074	UTSW	13	113368152	missense	probably benign	0.02
R6857:BC067074	UTSW	13	113319958	missense	probably damaging	0.97
R6934:BC067074	UTSW	13	113369266	missense	probably benign
R7019:BC067074	UTSW	13	113351750	missense	probably benign	0.01
R7100:BC067074	UTSW	13	113318967	missense
R7115:BC067074	UTSW	13	113320776	missense
R7152:BC067074	UTSW	13	113318850	missense
R7195:BC067074	UTSW	13	113367929	missense
R7213:BC067074	UTSW	13	113317941	missense
R7250:BC067074	UTSW	13	113318815	missense
R7341:BC067074	UTSW	13	113318172	missense
R7358:BC067074	UTSW	13	113319967	missense
R7359:BC067074	UTSW	13	113342430	missense
R7396:BC067074	UTSW	13	113318990	missense
R7632:BC067074	UTSW	13	113320886	missense
R7689:BC067074	UTSW	13	113379414	missense
R7713:BC067074	UTSW	13	113346541	missense
R7892:BC067074	UTSW	13	113319606	missense
R7975:BC067074	UTSW	13	113319307	missense
R8017:BC067074	UTSW	13	113319623	missense
R8019:BC067074	UTSW	13	113319623	missense
R8034:BC067074	UTSW	13	113342511	missense
R8101:BC067074	UTSW	13	113320891	missense
R8104:BC067074	UTSW	13	113319729	missense
R8122:BC067074	UTSW	13	113318908	missense
R8126:BC067074	UTSW	13	113368163	missense
R8272:BC067074	UTSW	13	113368355	missense
R8679:BC067074	UTSW	13	113351629	missense
R8973:BC067074	UTSW	13	113319759	missense
R9123:BC067074	UTSW	13	113368840	missense
R9125:BC067074	UTSW	13	113368840	missense
R9182:BC067074	UTSW	13	113320824	missense
R9233:BC067074	UTSW	13	113366220	missense
R9264:BC067074	UTSW	13	113319480	missense
R9306:BC067074	UTSW	13	113369476	missense	unknown
R9327:BC067074	UTSW	13	113317176	missense
R9411:BC067074	UTSW	13	113368233	missense
R9516:BC067074	UTSW	13	113319115	missense
R9562:BC067074	UTSW	13	113368040	missense
R9605:BC067074	UTSW	13	113319969	missense

Predicted Primers

PCR Primer
(F):5'- TTTATTTCAGTCCGGCAGAGG -3'
(R):5'- GAGACAAGAGCATCCCGTAATG -3'

Sequencing Primer
(F):5'- CCTTGGAAATCCATGAGGGTCTAC -3'
(R):5'- GTAATGCTCTCTTTTCCAAATTGGC -3'

Posted On

2018-10-18