Incidental Mutation 'R6889:Smc1b'
ID 537130
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Name structural maintenance of chromosomes 1B
Synonyms Smc1l2, SMC1beta
MMRRC Submission 044983-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 84948890-85016158 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84951960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1157 (L1157Q)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068] [ENSMUST00000023069] [ENSMUST00000227591] [ENSMUST00000229203]
AlphaFold Q920F6
Predicted Effect probably damaging
Transcript: ENSMUST00000023068
AA Change: L1157Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: L1157Q

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023069
SMART Domains Protein: ENSMUSP00000023069
Gene: ENSMUSG00000022434

DomainStartEndE-ValueType
Pfam:SIR2_2 142 286 7.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227591
Predicted Effect probably benign
Transcript: ENSMUST00000229203
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,290 (GRCm39) D103E probably benign Het
Abcc3 A T 11: 94,266,381 (GRCm39) S70T possibly damaging Het
Atp6v0a1 A G 11: 100,920,009 (GRCm39) Y214C possibly damaging Het
Azi2 A G 9: 117,878,963 (GRCm39) probably null Het
Cacnb2 T A 2: 14,990,826 (GRCm39) V636E possibly damaging Het
Cd8a A C 6: 71,351,546 (GRCm39) T169P probably damaging Het
Cfap44 G A 16: 44,224,495 (GRCm39) V68I probably benign Het
Cspg4b C A 13: 113,454,912 (GRCm39) S319R probably damaging Het
Dnaaf10 G A 11: 17,172,309 (GRCm39) V133M probably damaging Het
Eea1 G T 10: 95,873,340 (GRCm39) C1134F probably benign Het
Ehmt2 T G 17: 35,131,748 (GRCm39) F1192V probably damaging Het
Emc1 T C 4: 139,092,661 (GRCm39) F531L probably damaging Het
Eme1 G A 11: 94,541,303 (GRCm39) T173I probably benign Het
Gli2 A T 1: 118,772,146 (GRCm39) C520S probably damaging Het
Gm43302 T C 5: 105,428,004 (GRCm39) K186E probably benign Het
Gpr108 A T 17: 57,543,990 (GRCm39) N405K probably damaging Het
Hmgcl C A 4: 135,682,953 (GRCm39) T135N probably benign Het
Hydin G A 8: 111,259,488 (GRCm39) D2487N possibly damaging Het
Igfl3 G T 7: 17,913,725 (GRCm39) R25L probably benign Het
Igsf10 A C 3: 59,239,354 (GRCm39) S276A probably benign Het
Kctd1 A G 18: 15,107,045 (GRCm39) S211P probably damaging Het
Kctd7 A T 5: 130,181,342 (GRCm39) Q255L probably benign Het
Lrig1 A G 6: 94,602,044 (GRCm39) Y270H probably benign Het
Muc5ac C T 7: 141,363,481 (GRCm39) probably benign Het
Myh15 A G 16: 48,973,474 (GRCm39) N1248S possibly damaging Het
Nod1 A G 6: 54,921,094 (GRCm39) F408S probably benign Het
Nrp1 T C 8: 129,219,538 (GRCm39) F652S probably damaging Het
Opa1 G T 16: 29,439,686 (GRCm39) R792L probably benign Het
Or10ak14 G A 4: 118,611,504 (GRCm39) T79I probably damaging Het
Or51t4 A T 7: 102,597,975 (GRCm39) H91L possibly damaging Het
Or5p63 A T 7: 107,811,125 (GRCm39) F204I probably benign Het
Or6c74 T C 10: 129,870,401 (GRCm39) M302T probably benign Het
Pcdha6 G T 18: 37,101,396 (GRCm39) L196F probably damaging Het
Pdia2 A T 17: 26,415,944 (GRCm39) Y347* probably null Het
Pdpr G T 8: 111,851,245 (GRCm39) probably null Het
Pigt T A 2: 164,349,251 (GRCm39) L518Q probably damaging Het
Ppfibp2 A C 7: 107,337,188 (GRCm39) D591A possibly damaging Het
Prrg2 G A 7: 44,709,413 (GRCm39) T97M possibly damaging Het
Qars1 A G 9: 108,390,382 (GRCm39) T428A probably damaging Het
Rai1 T C 11: 60,076,541 (GRCm39) F202L probably damaging Het
Rars1 A T 11: 35,699,313 (GRCm39) M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,229,132 (GRCm39) probably benign Het
Slc16a6 A C 11: 109,345,866 (GRCm39) F382V probably damaging Het
Slc30a7 T C 3: 115,747,802 (GRCm39) T330A probably damaging Het
Snx4 G T 16: 33,071,840 (GRCm39) A4S possibly damaging Het
Sv2b A C 7: 74,775,515 (GRCm39) probably null Het
Syt9 A T 7: 107,024,493 (GRCm39) I129L probably damaging Het
Ttbk2 T C 2: 120,603,834 (GRCm39) E198G probably damaging Het
Ubr3 A T 2: 69,774,644 (GRCm39) D488V possibly damaging Het
Ush2a T A 1: 188,530,068 (GRCm39) C3286S probably damaging Het
Vill A G 9: 118,894,950 (GRCm39) D56G possibly damaging Het
Vmn1r41 A T 6: 89,724,352 (GRCm39) I298F probably damaging Het
Vmn2r2 A T 3: 64,024,688 (GRCm39) V631D probably damaging Het
Vmn2r32 A G 7: 7,475,573 (GRCm39) S437P possibly damaging Het
Vmn2r53 A G 7: 12,335,069 (GRCm39) V197A probably benign Het
Wasf1 A T 10: 40,796,365 (GRCm39) I32F probably damaging Het
Wasf2 G T 4: 132,922,041 (GRCm39) A387S unknown Het
Zbtb14 G A 17: 69,694,674 (GRCm39) C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 (GRCm39) A37S probably damaging Het
Zfp532 A G 18: 65,820,061 (GRCm39) E882G possibly damaging Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85,013,901 (GRCm39) missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85,016,099 (GRCm39) missense probably damaging 1.00
IGL01656:Smc1b APN 15 84,998,977 (GRCm39) missense probably damaging 0.99
IGL01807:Smc1b APN 15 84,980,946 (GRCm39) missense probably damaging 0.97
IGL02094:Smc1b APN 15 84,982,092 (GRCm39) splice site probably benign
IGL02121:Smc1b APN 15 84,982,186 (GRCm39) missense probably benign
IGL02631:Smc1b APN 15 84,991,204 (GRCm39) missense probably damaging 0.98
IGL02678:Smc1b APN 15 84,949,201 (GRCm39) nonsense probably null
IGL03197:Smc1b APN 15 84,955,064 (GRCm39) missense possibly damaging 0.85
IGL03214:Smc1b APN 15 84,982,147 (GRCm39) nonsense probably null
IGL03218:Smc1b APN 15 84,973,914 (GRCm39) missense probably benign 0.07
IGL03232:Smc1b APN 15 85,013,921 (GRCm39) missense possibly damaging 0.68
adamantine UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
unbreakable UTSW 15 84,980,859 (GRCm39) missense probably benign
E0370:Smc1b UTSW 15 85,011,782 (GRCm39) missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 84,953,852 (GRCm39) missense possibly damaging 0.91
R0092:Smc1b UTSW 15 84,951,925 (GRCm39) unclassified probably benign
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0106:Smc1b UTSW 15 84,955,020 (GRCm39) missense probably damaging 1.00
R0207:Smc1b UTSW 15 85,007,960 (GRCm39) missense probably benign
R0390:Smc1b UTSW 15 84,950,478 (GRCm39) missense probably damaging 1.00
R0440:Smc1b UTSW 15 84,996,874 (GRCm39) splice site probably benign
R0685:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R1109:Smc1b UTSW 15 84,997,016 (GRCm39) missense probably damaging 0.98
R1392:Smc1b UTSW 15 84,991,271 (GRCm39) splice site probably benign
R1509:Smc1b UTSW 15 84,970,335 (GRCm39) missense probably benign
R1804:Smc1b UTSW 15 85,011,991 (GRCm39) missense possibly damaging 0.90
R1879:Smc1b UTSW 15 84,976,268 (GRCm39) missense probably benign 0.01
R2086:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2143:Smc1b UTSW 15 85,008,003 (GRCm39) missense probably benign
R2158:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2174:Smc1b UTSW 15 85,006,052 (GRCm39) splice site probably benign
R2471:Smc1b UTSW 15 84,976,218 (GRCm39) missense probably damaging 0.98
R3689:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R3690:Smc1b UTSW 15 85,001,464 (GRCm39) intron probably benign
R4178:Smc1b UTSW 15 85,004,848 (GRCm39) missense possibly damaging 0.94
R4420:Smc1b UTSW 15 84,997,031 (GRCm39) missense probably damaging 1.00
R4905:Smc1b UTSW 15 84,950,428 (GRCm39) missense probably damaging 1.00
R4919:Smc1b UTSW 15 85,001,305 (GRCm39) intron probably benign
R5114:Smc1b UTSW 15 84,949,185 (GRCm39) missense probably damaging 1.00
R5314:Smc1b UTSW 15 84,955,066 (GRCm39) missense probably benign 0.00
R5476:Smc1b UTSW 15 84,970,352 (GRCm39) missense probably damaging 0.97
R5593:Smc1b UTSW 15 85,005,842 (GRCm39) missense probably benign 0.06
R5690:Smc1b UTSW 15 84,996,974 (GRCm39) missense probably damaging 1.00
R5719:Smc1b UTSW 15 84,980,859 (GRCm39) missense probably benign
R5817:Smc1b UTSW 15 84,951,984 (GRCm39) missense probably damaging 0.99
R5834:Smc1b UTSW 15 84,973,866 (GRCm39) missense probably damaging 1.00
R5930:Smc1b UTSW 15 84,970,322 (GRCm39) missense probably damaging 1.00
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6032:Smc1b UTSW 15 84,950,430 (GRCm39) missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85,005,896 (GRCm39) missense probably damaging 1.00
R6306:Smc1b UTSW 15 85,011,824 (GRCm39) missense probably benign 0.30
R6392:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6426:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6435:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6436:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6437:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6508:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6512:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6703:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6737:Smc1b UTSW 15 84,976,232 (GRCm39) missense probably benign 0.03
R6775:Smc1b UTSW 15 84,973,881 (GRCm39) missense probably damaging 0.96
R6908:Smc1b UTSW 15 84,991,211 (GRCm39) missense probably damaging 1.00
R7124:Smc1b UTSW 15 84,955,798 (GRCm39) missense probably damaging 0.98
R7400:Smc1b UTSW 15 84,953,921 (GRCm39) missense probably damaging 1.00
R7417:Smc1b UTSW 15 84,981,743 (GRCm39) missense probably benign 0.05
R7610:Smc1b UTSW 15 84,955,021 (GRCm39) missense possibly damaging 0.92
R7873:Smc1b UTSW 15 84,994,851 (GRCm39) critical splice donor site probably null
R7890:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8004:Smc1b UTSW 15 84,981,815 (GRCm39) missense probably damaging 0.98
R8698:Smc1b UTSW 15 84,997,047 (GRCm39) missense probably benign 0.16
R8826:Smc1b UTSW 15 84,950,529 (GRCm39) missense probably damaging 1.00
R8835:Smc1b UTSW 15 85,013,949 (GRCm39) missense possibly damaging 0.83
R8925:Smc1b UTSW 15 84,991,273 (GRCm39) splice site probably null
R9059:Smc1b UTSW 15 85,004,875 (GRCm39) nonsense probably null
R9149:Smc1b UTSW 15 84,950,431 (GRCm39) missense probably benign 0.00
R9241:Smc1b UTSW 15 84,976,209 (GRCm39) missense probably benign 0.00
R9245:Smc1b UTSW 15 85,004,846 (GRCm39) missense probably benign 0.03
R9301:Smc1b UTSW 15 85,011,995 (GRCm39) missense probably damaging 0.98
R9384:Smc1b UTSW 15 84,950,455 (GRCm39) missense probably damaging 0.99
R9750:Smc1b UTSW 15 85,016,106 (GRCm39) missense probably damaging 1.00
Z1176:Smc1b UTSW 15 85,016,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGCACAAGACTTCTCTC -3'
(R):5'- TGGTAGCACAAGACTTCTCTC -3'

Sequencing Primer
(F):5'- GGTCGACCACAGAGTGCTTTAATTC -3'
(R):5'- TAGCACAAGACTTCTCTCAGAGGTTC -3'
Posted On 2018-10-18