Incidental Mutation 'R6889:Snx4'
ID 537132
Institutional Source Beutler Lab
Gene Symbol Snx4
Ensembl Gene ENSMUSG00000022808
Gene Name sorting nexin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R6889 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 33251442-33300269 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33251470 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 4 (A4S)
Ref Sequence ENSEMBL: ENSMUSP00000023502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023502] [ENSMUST00000231389]
AlphaFold Q91YJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000023502
AA Change: A4S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023502
Gene: ENSMUSG00000022808
AA Change: A4S

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
PX 56 184 1.86e-34 SMART
low complexity region 237 248 N/A INTRINSIC
coiled coil region 369 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231389
AA Change: A4S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associated with the long isoform of the leptin receptor and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor in cell cultures, but its function is unknown. This protein may form oligomeric complexes with family members. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,943,053 D103E probably benign Het
Abcc3 A T 11: 94,375,555 S70T possibly damaging Het
Atp6v0a1 A G 11: 101,029,183 Y214C possibly damaging Het
Azi2 A G 9: 118,049,895 probably null Het
BC067074 C A 13: 113,318,378 S319R probably damaging Het
Cacnb2 T A 2: 14,986,015 V636E possibly damaging Het
Cd8a A C 6: 71,374,562 T169P probably damaging Het
Cfap44 G A 16: 44,404,132 V68I probably benign Het
Eea1 G T 10: 96,037,478 C1134F probably benign Het
Ehmt2 T G 17: 34,912,772 F1192V probably damaging Het
Emc1 T C 4: 139,365,350 F531L probably damaging Het
Eme1 G A 11: 94,650,477 T173I probably benign Het
Gli2 A T 1: 118,844,416 C520S probably damaging Het
Gm43302 T C 5: 105,280,138 K186E probably benign Het
Gpr108 A T 17: 57,236,990 N405K probably damaging Het
Hmgcl C A 4: 135,955,642 T135N probably benign Het
Hydin G A 8: 110,532,856 D2487N possibly damaging Het
Igfl3 G T 7: 18,179,800 R25L probably benign Het
Igsf10 A C 3: 59,331,933 S276A probably benign Het
Kctd1 A G 18: 14,973,988 S211P probably damaging Het
Kctd7 A T 5: 130,152,501 Q255L probably benign Het
Lrig1 A G 6: 94,625,063 Y270H probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A G 16: 49,153,111 N1248S possibly damaging Het
Nod1 A G 6: 54,944,109 F408S probably benign Het
Nrp1 T C 8: 128,493,057 F652S probably damaging Het
Olfr1338 G A 4: 118,754,307 T79I probably damaging Het
Olfr487 A T 7: 108,211,918 F204I probably benign Het
Olfr574 A T 7: 102,948,768 H91L possibly damaging Het
Olfr821 T C 10: 130,034,532 M302T probably benign Het
Opa1 G T 16: 29,620,868 R792L probably benign Het
Pcdha6 G T 18: 36,968,343 L196F probably damaging Het
Pdia2 A T 17: 26,196,970 Y347* probably null Het
Pdpr G T 8: 111,124,613 probably null Het
Pigt T A 2: 164,507,331 L518Q probably damaging Het
Ppfibp2 A C 7: 107,737,981 D591A possibly damaging Het
Prrg2 G A 7: 45,059,989 T97M possibly damaging Het
Qars A G 9: 108,513,183 T428A probably damaging Het
Rai1 T C 11: 60,185,715 F202L probably damaging Het
Rars A T 11: 35,808,486 M660K probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a6 A C 11: 109,455,040 F382V probably damaging Het
Slc30a7 T C 3: 115,954,153 T330A probably damaging Het
Smc1b A T 15: 85,067,759 L1157Q probably damaging Het
Sv2b A C 7: 75,125,767 probably null Het
Syt9 A T 7: 107,425,286 I129L probably damaging Het
Ttbk2 T C 2: 120,773,353 E198G probably damaging Het
Ubr3 A T 2: 69,944,300 D488V possibly damaging Het
Ush2a T A 1: 188,797,871 C3286S probably damaging Het
Vill A G 9: 119,065,882 D56G possibly damaging Het
Vmn1r41 A T 6: 89,747,370 I298F probably damaging Het
Vmn2r2 A T 3: 64,117,267 V631D probably damaging Het
Vmn2r32 A G 7: 7,472,574 S437P possibly damaging Het
Vmn2r53 A G 7: 12,601,142 V197A probably benign Het
Wasf1 A T 10: 40,920,369 I32F probably damaging Het
Wasf2 G T 4: 133,194,730 A387S unknown Het
Wdr92 G A 11: 17,222,309 V133M probably damaging Het
Zbtb14 G A 17: 69,387,679 C124Y probably damaging Het
Zfp462 G T 4: 55,007,671 A37S probably damaging Het
Zfp532 A G 18: 65,686,990 E882G possibly damaging Het
Other mutations in Snx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Snx4 APN 16 33264254 splice site probably benign
IGL01831:Snx4 APN 16 33284422 nonsense probably null
IGL02069:Snx4 APN 16 33264355 missense probably damaging 1.00
IGL03204:Snx4 APN 16 33269669 missense probably benign 0.01
R1336:Snx4 UTSW 16 33280680 missense probably benign 0.20
R1613:Snx4 UTSW 16 33286046 missense probably damaging 1.00
R1901:Snx4 UTSW 16 33284438 missense possibly damaging 0.95
R2177:Snx4 UTSW 16 33286058 splice site probably null
R3147:Snx4 UTSW 16 33287724 missense probably benign 0.08
R3148:Snx4 UTSW 16 33287724 missense probably benign 0.08
R4380:Snx4 UTSW 16 33264296 missense probably damaging 1.00
R4924:Snx4 UTSW 16 33294730 missense probably benign 0.04
R6904:Snx4 UTSW 16 33294738 missense probably damaging 0.97
R7355:Snx4 UTSW 16 33266866 missense probably damaging 1.00
R7937:Snx4 UTSW 16 33291829 missense probably damaging 1.00
R9234:Snx4 UTSW 16 33266791 nonsense probably null
R9234:Snx4 UTSW 16 33287699 missense probably benign 0.00
R9457:Snx4 UTSW 16 33286010 missense probably benign 0.01
R9524:Snx4 UTSW 16 33291858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGCCAACCCTCTGTAGTC -3'
(R):5'- GTGAGTCCATTTCCACTCCG -3'

Sequencing Primer
(F):5'- AACCCTCTGTAGTCGCCCTAG -3'
(R):5'- ATCGGGTCATCCTCCGGTC -3'
Posted On 2018-10-18