Incidental Mutation 'R6890:Dusp10'
ID537142
Institutional Source Beutler Lab
Gene Symbol Dusp10
Ensembl Gene ENSMUSG00000039384
Gene Namedual specificity phosphatase 10
SynonymsMKP5, 2610306G15Rik, MKP-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location184013302-184075636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 184069196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 387 (Y387D)
Ref Sequence ENSEMBL: ENSMUSP00000045838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655]
Predicted Effect probably damaging
Transcript: ENSMUST00000048655
AA Change: Y387D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384
AA Change: Y387D

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Meta Mutation Damage Score 0.8616 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display alterations in both innate and adaptive immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Dusp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Dusp10 APN 1 184069131 missense probably benign 0.00
IGL01094:Dusp10 APN 1 184037500 splice site probably null
IGL01380:Dusp10 APN 1 184069014 missense possibly damaging 0.93
FR4449:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4548:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4737:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4976:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
LCD18:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
R0369:Dusp10 UTSW 1 184069056 missense probably damaging 1.00
R0433:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R0464:Dusp10 UTSW 1 184069076 missense probably benign 0.01
R1112:Dusp10 UTSW 1 184036900 missense probably damaging 0.98
R1474:Dusp10 UTSW 1 184037448 splice site probably null
R1667:Dusp10 UTSW 1 184036858 missense probably damaging 1.00
R1719:Dusp10 UTSW 1 184037225 missense probably benign 0.22
R1899:Dusp10 UTSW 1 184069180 missense possibly damaging 0.64
R5238:Dusp10 UTSW 1 184037013 missense possibly damaging 0.94
R5277:Dusp10 UTSW 1 184037007 missense possibly damaging 0.94
R5742:Dusp10 UTSW 1 184037656 splice site probably null
R5948:Dusp10 UTSW 1 184068876 missense probably benign
R6969:Dusp10 UTSW 1 184068888 missense probably damaging 1.00
R7007:Dusp10 UTSW 1 184037217 missense probably benign 0.22
R7033:Dusp10 UTSW 1 184037605 missense possibly damaging 0.94
R7436:Dusp10 UTSW 1 184069221 missense probably damaging 1.00
R7447:Dusp10 UTSW 1 184068956 missense probably benign
R7479:Dusp10 UTSW 1 184037420 missense probably damaging 0.99
R7572:Dusp10 UTSW 1 184074309 missense probably damaging 1.00
R8191:Dusp10 UTSW 1 184037552 missense possibly damaging 0.89
R8201:Dusp10 UTSW 1 184037005 missense possibly damaging 0.51
Z1177:Dusp10 UTSW 1 184068992 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCTGTTCCTCGGCAATGAG -3'
(R):5'- ATTATGCCCATCCAGGTAGTTCTG -3'

Sequencing Primer
(F):5'- TTCCTCGGCAATGAGCAGGATG -3'
(R):5'- CATCCAGGTAGTTCTGAGACTAACAG -3'
Posted On2018-10-18