Incidental Mutation 'R6890:Zgpat'
ID537145
Institutional Source Beutler Lab
Gene Symbol Zgpat
Ensembl Gene ENSMUSG00000027582
Gene Namezinc finger, CCCH-type with G patch domain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181364928-181383628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 181378511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 237 (I237N)
Ref Sequence ENSEMBL: ENSMUSP00000112067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029105] [ENSMUST00000048077] [ENSMUST00000108804] [ENSMUST00000108807] [ENSMUST00000116366]
Predicted Effect probably damaging
Transcript: ENSMUST00000029105
AA Change: I237N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029105
Gene: ENSMUSG00000027582
AA Change: I237N

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048077
SMART Domains Protein: ENSMUSP00000045010
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 27 266 5.6e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108804
SMART Domains Protein: ENSMUSP00000104432
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 27 87 9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108807
AA Change: I237N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104435
Gene: ENSMUSG00000027582
AA Change: I237N

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116366
AA Change: I237N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112067
Gene: ENSMUSG00000027582
AA Change: I237N

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
ZnF_C3H1 174 199 5.99e-4 SMART
SCOP:d1g5va_ 218 268 2e-3 SMART
low complexity region 270 287 N/A INTRINSIC
G_patch 311 357 1.34e-9 SMART
low complexity region 379 392 N/A INTRINSIC
coiled coil region 431 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126611
SMART Domains Protein: ENSMUSP00000119181
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 4 246 9.6e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140943
SMART Domains Protein: ENSMUSP00000117558
Gene: ENSMUSG00000090077

DomainStartEndE-ValueType
Pfam:LIME1 24 189 5.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156258
SMART Domains Protein: ENSMUSP00000122714
Gene: ENSMUSG00000027582

DomainStartEndE-ValueType
G_patch 1 44 1.18e-5 SMART
low complexity region 66 79 N/A INTRINSIC
coiled coil region 117 148 N/A INTRINSIC
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Other mutations in Zgpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Zgpat APN 2 181378889 missense probably benign 0.02
IGL02221:Zgpat APN 2 181378858 missense probably benign 0.41
IGL02507:Zgpat APN 2 181366236 missense probably damaging 1.00
IGL03124:Zgpat APN 2 181366180 missense probably benign 0.05
R0559:Zgpat UTSW 2 181380192 splice site probably benign
R1451:Zgpat UTSW 2 181380191 splice site probably benign
R1541:Zgpat UTSW 2 181378865 missense probably benign 0.01
R1758:Zgpat UTSW 2 181378840 missense probably damaging 1.00
R2445:Zgpat UTSW 2 181366160 nonsense probably null
R3038:Zgpat UTSW 2 181366018 unclassified probably benign
R3700:Zgpat UTSW 2 181365646 unclassified probably benign
R4888:Zgpat UTSW 2 181378858 missense probably benign 0.41
R5594:Zgpat UTSW 2 181365627 unclassified probably benign
R7023:Zgpat UTSW 2 181366018 unclassified probably benign
R7350:Zgpat UTSW 2 181380435 missense
R7396:Zgpat UTSW 2 181366089 missense probably benign 0.00
R7964:Zgpat UTSW 2 181378481 missense probably benign 0.03
Z1176:Zgpat UTSW 2 181365729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTCTAAGCCTCTGTC -3'
(R):5'- CCACATCTAGGGTGACAGAGAC -3'

Sequencing Primer
(F):5'- ATGTCTAAGCCTCTGTCTTCTGTG -3'
(R):5'- CAGCAGTTTTTACAGGTTAGGCAAC -3'
Posted On2018-10-18