Incidental Mutation 'R6890:Ambp'
ID537146
Institutional Source Beutler Lab
Gene Symbol Ambp
Ensembl Gene ENSMUSG00000028356
Gene Namealpha 1 microglobulin/bikunin
SynonymsUTI, Urinary Trypsin Inhibitor, ulinastatin, Itil, HI-30, Intin4, ASPI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63143275-63154799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 63150359 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 140 (H140Q)
Ref Sequence ENSEMBL: ENSMUSP00000030041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030041] [ENSMUST00000142901]
Predicted Effect probably benign
Transcript: ENSMUST00000030041
AA Change: H140Q

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030041
Gene: ENSMUSG00000028356
AA Change: H140Q

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 40 185 4.4e-32 PFAM
KU 228 281 1.55e-20 SMART
KU 284 337 4.58e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142901
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a fusion protein that undergoes proteolytic processing to generate two mature proteins: alpha-1-microglobulin (A1m) is a heme-binding plasma glycoprotein of the lipocalin superfamily of proteins that bind to hydrophobic molecules, whereas bikunin belongs to the superfamily of Kunitz-type protease inhibitors. The transgenic mice specifically lacking bikunin, but not A1m, exhibit female infertility and an increased sensitivity to lung metastasis. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female homozygotes for targeted null mutations exhibit reduced ovulation rates, oocytes lacking a zona pellucida, and a very low fertilization rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Ambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Ambp APN 4 63154018 missense possibly damaging 0.93
IGL00769:Ambp APN 4 63144165 missense probably damaging 0.99
IGL01400:Ambp APN 4 63152722 missense probably damaging 1.00
IGL01646:Ambp APN 4 63148740 missense probably benign 0.04
IGL02338:Ambp APN 4 63143697 missense probably damaging 1.00
IGL02796:Ambp APN 4 63153932 splice site probably benign
PIT4131001:Ambp UTSW 4 63144265 missense probably damaging 1.00
PIT4791001:Ambp UTSW 4 63154061 start gained probably benign
R0885:Ambp UTSW 4 63151468 missense probably damaging 0.98
R1725:Ambp UTSW 4 63144276 missense possibly damaging 0.92
R1999:Ambp UTSW 4 63149429 missense possibly damaging 0.63
R2023:Ambp UTSW 4 63151465 missense probably damaging 1.00
R2290:Ambp UTSW 4 63143687 missense probably damaging 1.00
R3436:Ambp UTSW 4 63149484 missense probably benign 0.03
R3437:Ambp UTSW 4 63149484 missense probably benign 0.03
R4078:Ambp UTSW 4 63150443 missense probably damaging 0.98
R4409:Ambp UTSW 4 63152647 missense probably damaging 1.00
R4979:Ambp UTSW 4 63152651 missense probably benign 0.07
R6738:Ambp UTSW 4 63149474 missense probably benign
R6818:Ambp UTSW 4 63154006 nonsense probably null
R7934:Ambp UTSW 4 63149440 missense probably damaging 1.00
R8022:Ambp UTSW 4 63144197 missense probably damaging 1.00
R8671:Ambp UTSW 4 63150419 nonsense probably null
X0057:Ambp UTSW 4 63149505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAATTCTACTTCACCCAGGATG -3'
(R):5'- ATGGATGTGGACACGCTGAG -3'

Sequencing Primer
(F):5'- ATGCTGAGCTATTCAAGGCC -3'
(R):5'- CACGCTGAGTGGAGGATG -3'
Posted On2018-10-18