Incidental Mutation 'R6890:Epb41'
ID537148
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Nameerythrocyte membrane protein band 4.1
SynonymsEpb4.1, 4.1R, D4Ertd442e, Elp1, Elp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location131923413-132075321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131935829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 681 (D681E)
Ref Sequence ENSEMBL: ENSMUSP00000081274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030739
AA Change: D735E

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906
AA Change: D735E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054917
AA Change: D681E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906
AA Change: D681E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084253
AA Change: D681E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906
AA Change: D681E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105970
AA Change: D550E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906
AA Change: D550E

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105972
AA Change: D735E

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906
AA Change: D735E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105974
AA Change: D646E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906
AA Change: D646E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105975
AA Change: D746E

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906
AA Change: D746E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105981
AA Change: D735E

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906
AA Change: D735E

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121764
Gene: ENSMUSG00000028906
AA Change: D251E

DomainStartEndE-ValueType
Pfam:SAB 28 76 2e-24 PFAM
low complexity region 148 159 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
Pfam:4_1_CTD 264 371 6.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137846
AA Change: D544E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906
AA Change: D544E

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122234
Gene: ENSMUSG00000028906
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Pfam:SAB 53 101 7e-26 PFAM
Pfam:4_1_CTD 139 246 2.8e-52 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116599
Gene: ENSMUSG00000028906
AA Change: D73E

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
Pfam:4_1_CTD 86 193 1.5e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131974731 missense probably benign
IGL00897:Epb41 APN 4 132000197 splice site probably null
IGL00911:Epb41 APN 4 131989784 missense possibly damaging 0.60
IGL01390:Epb41 APN 4 132003737 missense probably benign
IGL01459:Epb41 APN 4 131964128 intron probably benign
IGL01816:Epb41 APN 4 132003695 missense probably benign 0.00
IGL02192:Epb41 APN 4 131929717 missense probably damaging 0.99
IGL02296:Epb41 APN 4 132003754 missense probably benign 0.42
IGL03011:Epb41 APN 4 132003794 missense probably damaging 1.00
IGL03268:Epb41 APN 4 131928495 missense probably damaging 1.00
IGL03388:Epb41 APN 4 131974794 missense probably damaging 1.00
R0355:Epb41 UTSW 4 132000261 missense probably damaging 0.99
R0532:Epb41 UTSW 4 131978795 splice site probably benign
R0550:Epb41 UTSW 4 131975613 missense probably damaging 1.00
R0571:Epb41 UTSW 4 131989904 missense probably damaging 1.00
R1158:Epb41 UTSW 4 132000191 splice site probably benign
R1444:Epb41 UTSW 4 132006071 missense probably benign
R2106:Epb41 UTSW 4 131989841 missense probably damaging 1.00
R2269:Epb41 UTSW 4 131964147 missense probably benign 0.09
R4014:Epb41 UTSW 4 131982445 splice site probably benign
R4017:Epb41 UTSW 4 131982445 splice site probably benign
R4952:Epb41 UTSW 4 132000270 missense probably damaging 0.99
R4976:Epb41 UTSW 4 131937436 unclassified probably benign
R5058:Epb41 UTSW 4 132007435 utr 5 prime probably benign
R5119:Epb41 UTSW 4 131937436 unclassified probably benign
R5229:Epb41 UTSW 4 131978935 missense probably damaging 1.00
R5571:Epb41 UTSW 4 131937406 unclassified probably benign
R6250:Epb41 UTSW 4 131989873 missense probably damaging 1.00
R6531:Epb41 UTSW 4 131957636 missense probably benign 0.00
R7265:Epb41 UTSW 4 131967834 missense unknown
R7289:Epb41 UTSW 4 131991209 critical splice donor site probably null
R7322:Epb41 UTSW 4 131989719 missense probably damaging 0.99
R7823:Epb41 UTSW 4 131974682 critical splice donor site probably null
R8296:Epb41 UTSW 4 131937461 missense
R8317:Epb41 UTSW 4 131957650 missense
R8401:Epb41 UTSW 4 131974707 missense probably damaging 1.00
R8880:Epb41 UTSW 4 131967793 missense
X0066:Epb41 UTSW 4 131974740 missense probably damaging 1.00
Z1177:Epb41 UTSW 4 132006083 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCACTCAAGGTCTTTCAGG -3'
(R):5'- TGTCCTTTGGAGAGCGACTC -3'

Sequencing Primer
(F):5'- ACTCAAGGTCTTTCAGGCTAGC -3'
(R):5'- GAGAGCGACTCCAACCTTTG -3'
Posted On2018-10-18