Incidental Mutation 'R6890:Malsu1'
ID537151
Institutional Source Beutler Lab
Gene Symbol Malsu1
Ensembl Gene ENSMUSG00000029815
Gene Namemitochondrial assembly of ribosomal large subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location49073795-49086751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49075251 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 135 (Y135C)
Ref Sequence ENSEMBL: ENSMUSP00000122941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114500] [ENSMUST00000128616] [ENSMUST00000204260]
Predicted Effect probably benign
Transcript: ENSMUST00000114500
SMART Domains Protein: ENSMUSP00000110144
Gene: ENSMUSG00000029815

DomainStartEndE-ValueType
Pfam:Oligomerisation 18 69 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128616
AA Change: Y135C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122941
Gene: ENSMUSG00000029815
AA Change: Y135C

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:Oligomerisation 94 195 3.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204260
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Meta Mutation Damage Score 0.5576 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Malsu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Malsu1 APN 6 49075187 missense probably damaging 1.00
R4631:Malsu1 UTSW 6 49084533 missense probably damaging 1.00
R8691:Malsu1 UTSW 6 49075237 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCAGATCACATTGGTGCCAAG -3'
(R):5'- CAGACTCCTAGTGTCTTCTGGC -3'

Sequencing Primer
(F):5'- CACATTGGTGCCAAGTTTGAC -3'
(R):5'- CACGAATTAGAAATTATCTGGGCTCG -3'
Posted On2018-10-18